Arctornis phrika

(Collenette, 1932) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Arctornis

At a glance

Occurrence records8

Data sources6

Biological traits0

DNA specimens17

eDNA detections16

Sources6 archives

Databases and archives Arctornis phrika's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD17 specimens

01Narrative

Arctornis phrika is een donsvlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1932 door Collenette.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctornis phrika has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

49Tmostly conserved

76Amostly conserved

82Tmostly conserved

100Amostly conserved

106Tmostly conserved

148Amostly conserved

160Amostly conserved

202Amostly conserved

217Avariable

247Tmostly conserved

250Tmostly conserved

286Tmostly conserved

295Tvariable

307Cmostly conserved

316Amostly conserved

363Cmostly conserved

412Tvariable

424Tmostly conserved

439Tmostly conserved

463Tmostly conserved

466Amostly conserved

478Cmostly conserved

481Cvariable

526Amostly conserved

547Gmostly conserved

548Tvariable

553Cvariable

562Gmostly conserved

565Amostly conserved

610Cvariable

622Amostly conserved

628Amostly conserved

639Tmostly conserved

652Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTCTAAGACTTTTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes6

BINs3

Most divergent pair3.2%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Datana ranaecepssame order8.2%Datana angusiisame order8.2%Datana neomexicanasame order8.4%Datana perfusasame order8.4%Negeta contrariatasame order8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 records

Wild obs. + sensor3

Museum / vouchered5

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Naturalis Biodiversity Centerlocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	2

2 institutions · 5 of 5 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Arctornis phrika was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.3 °C 20.1–25.9

Seasonal swing summer↔winter0.8 °C

Max temp (day)28.9 °C 24.3–29.8

Min temp (night)22.1 °C 16.2–22.5

Precipitation264 mm/mo 237–423

Air humidity70.8 % 65.1–71.6

Moisture balance139 mm/mo 97.2–275

Vapour deficit931 Pa 799–967

Wind speed0.9 m/s 0.6–1.70

Cloud cover68.5 % 43.3–73.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)