Negeta contrariata

Walker, 1862 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nolidae/Negeta

At a glance

Occurrence records647

Data sources6

Biological traits0

DNA specimens31

eDNA detections28

Sources6 archives

Databases and archives Negeta contrariata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility647 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF647 records

Environmental DNA1 datasets · 5 countries28 detections

DNA & barcodingBOLD31 specimens

01Narrative

Negeta contrariata is a moth in the family Nolidae first described by Francis Walker in 1862. It is found from the Indo-Australian tropics of India, Sri Lanka, Borneo east to Australia (Queensland) and the Bismarck Archipelago.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Negeta contrariata has left across the world's sequence archives.

At a glance

DNA specimens31

BINs5

Marker genes3

eDNA detections28

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 60 variable positions, in barcode order

31Tmostly conserved

43Amostly conserved

49Tmostly conserved

70Amostly conserved

82Tmostly conserved

88Tvariable

94Avariable

97Tmostly conserved

127Tmostly conserved

157Cvariable

163Avariable

166Avariable

169Amostly conserved

217Avariable

220Cmostly conserved

223Amostly conserved

232Tmostly conserved

235Tvariable

253Amostly conserved

266Cmostly conserved

271Cmostly conserved

277Amostly conserved

283Tmostly conserved

284Tmostly conserved

286Amostly conserved

287Cvariable

298Tmostly conserved

313Cvariable

319Tmostly conserved

334Amostly conserved

337Amostly conserved

340Tmostly conserved

343Cmostly conserved

346Amostly conserved

379Tmostly conserved

400Cvariable

401Cvariable

403Amostly conserved

412Tmostly conserved

415Amostly conserved

418Tmostly conserved

436Amostly conserved

451Amostly conserved

472Tmostly conserved

477Gvariable

487Tvariable

499Tmostly conserved

517Amostly conserved

529Tmostly conserved

539Tvariable

562Tmostly conserved

565Avariable

574Tmostly conserved

578Tmostly conserved

589Tmostly conserved

595Tvariable

616Tvariable

625Amostly conserved

628Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTCTTTTAATTCGAGCAGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes11

BINs5

Most divergent pair7.0%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leucochlaena turatiisame order6.5%Leucochlaena oditissame order6.5%Blenina albifasciasame family6.5%Hyposada hydrocampatasame order7.0%Datana perspicuasame order7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type647 records

Wild obs. + sensor558

Museum / vouchered89

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 172≤1 km 156≤10 km 8>10 km 17

353 georeferenced · 205 without coordinates

Open the mapobservation + sensor558

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 1≤1 km 1≤10 km 5

7 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	74
Museums Victorialocation not on record	6
Helsinki, FI	2
MZLUlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 85 of 89 vouchered records shown · 4 without an institution code

09Environmental DNA28 detections

Where the DNA of Negeta contrariata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map5 countries0

Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.3 °C 21.2–25.3

Seasonal swing summer↔winter7.30 °C

Max temp (day)26.0 °C 22.5–28.6

Min temp (night)21.0 °C 18.4–23.7

Precipitation185 mm/mo 55.5–398

Air humidity63.2 % 60.3–70.1

Moisture balance44.4 mm/mo -120–321

Vapour deficit1,036 Pa 916–1,117

Wind speed2.90 m/s 1.20–5.70

Cloud cover34.5 % 25.3–61.6

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)