Arctonoe vittata

(Grube, 1855) · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Phyllodocida/Polynoidae/Arctonoe

At a glance

Occurrence records525

Data sources11

Biological traits2

DNA specimens90

eDNA detections1

Sources11 archives

Databases and archives Arctonoe vittata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility438 records↗

OBISOcean Biodiversity Information System87 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics90 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS525 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD90 specimens

Genome at a glanceGoaT · NCBI≈1.4 Gbp

01Narrative

Arctonoe vittata is a species of scaled polychaete worms commonly known as a "scale worm". This species often lives as a commensal of another marine animal.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding90 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctonoe vittata has left across the world's sequence archives.

At a glance

DNA specimens90

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus78 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

34Cmostly conserved

38Tmostly conserved

88Gmostly conserved

169Cmostly conserved

172Amostly conserved

181Gmostly conserved

184Gmostly conserved

217Cmostly conserved

220Cmostly conserved

229Amostly conserved

274Amostly conserved

343Tmostly conserved

415Amostly conserved

428Tmostly conserved

466Amostly conserved

490Gmostly conserved

550Tvariable

556Amostly conserved

577Avariable

578Tmostly conserved

634Tmostly conserved

TACTCTATACTTTATTTTTGGTACTTGATCAGGCTTATTAGGAACTTCTATAAGTCTCCTAATTCGAGCAGAACTTGGCCAACCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes34

BINs2

Most divergent pair8.7%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctonoe fragilissame genus2.0%Arctonoe pulchrasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Arctonoe vittata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 449 430 753 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arctonoe vittata1.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type525 records

Wild obs. + sensor281

Museum / vouchered239

Other5

Range

Area of Occupancy AOO932 km²

Depth

0–200 m sunlit29

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 37.7 m · max 237.5 m · 30 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 110≤1 km 61≤10 km 5>10 km 10

186 georeferenced · 95 without coordinates

Open the mapobservation + sensor281

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 1≤1 km 21≤10 km 13>10 km 6

41 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence239

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	37
University of Guelph, Centre for Biodiversity Genomicslocation not on record	30
CASlocation not on record	23
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	19
Washington, US	19
Hakai Institutelocation not on record	7
Santa Barbara Museum of Natural Historylocation not on record	6
New Haven, US	3
Smithsonian Institution National Museum of Natural History, Department of Invertebrate Zoologylocation not on record	3
Edmonton, CA	2
Frankfurt am Main	2
Cambridge, US	1
Florida Museum of Natural Historylocation not on record	1
ArcODlocation not on record	1
Toronto, CA	1
Natural History Museum of Los Angeles Countylocation not on record	1

16 institutions · 156 of 239 vouchered records shown · 33 without an institution code

09Environmental DNA1 detections

Where the DNA of Arctonoe vittata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)