Arctonoe pulchra

(Johnson, 1897) · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Phyllodocida/Polynoidae/Arctonoe

At a glance

Occurrence records317

Data sources8

Biological traits2

DNA specimens39

eDNA detections51

Sources8 archives

Databases and archives Arctonoe pulchra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility242 records↗

OBISOcean Biodiversity Information System75 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS317 records

Environmental DNA1 datasets · 2 countries51 detections

DNA & barcodingBOLD39 specimens

01Narrative

Arctonoe pulchra is een borstelworm uit de familie Polynoidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Arctonoe pulchra werd in 1897 voor het eerst wetenschappelijk beschreven door Johnson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctonoe pulchra has left across the world's sequence archives.

At a glance

DNA specimens39

BINs1

Marker genes2

eDNA detections51

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

1Tmostly conserved

43Amostly conserved

79Amostly conserved

214Amostly conserved

560Gmostly conserved

561Cmostly conserved

562Amostly conserved

563Gmostly conserved

565Amostly conserved

566Gmostly conserved

567Cmostly conserved

568Tmostly conserved

569Amostly conserved

570Tmostly conserved

571Cmostly conserved

572Amostly conserved

573Cmostly conserved

574Tmostly conserved

575Amostly conserved

576Tmostly conserved

577Amostly conserved

578Tmostly conserved

580Amostly conserved

581Tmostly conserved

583Amostly conserved

585Cmostly conserved

586Amostly conserved

587Gmostly conserved

588Amostly conserved

589Tmostly conserved

590Cmostly conserved

591Gmostly conserved

592Tmostly conserved

619Cvariable

TACTCTATACTTTATTTTTGGTACTTGATCTGGTCTGTTGGGAACTTCTATAAGGCTCCTAATTCGAGCAGAACTTGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes13

BIN1

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctonoe vittatasame genus6.8%Arctonoe fragilissame genus7.3%Subadyte albanyensissame family17.5%Lepidasthenia berkeleyaesame family17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S-D9-D10

animal barcodemarker

08Occurrence & distribution

Record type317 records

Wild obs. + sensor181

Museum / vouchered134

Other2

Range

Area of Occupancy AOO504 km²

Depth

0–200 m sunlit11

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 24.4 m · max 164.6 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 69≤1 km 49≤10 km 6>10 km 4

128 georeferenced · 53 without coordinates

Open the mapobservation + sensor181

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 12≤1 km 5≤10 km 10>10 km 4

31 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	22
Victoria, CA	13
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
Santa Barbara Museum of Natural Historylocation not on record	9
Los Angeles, US	7
Cambridge, US	6
CASlocation not on record	6
Washington, US	4
Montgomery, US	2
Frankfurt am Main	2
Smithsonian Environmental Research Centerlocation not on record	1
Natural History Museum of Los Angeles Countylocation not on record	1

12 institutions · 85 of 134 vouchered records shown · 18 without an institution code

09Environmental DNA51 detections

Where the DNA of Arctonoe pulchra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map2 countries0

baychannelsoft sediment epibenthosrocky reef, Macrocystis pyrifera forestcobble field, crinoid fieldrocky reef, Nereocystis luetkeana forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 6.20–14.9

Seasonal swing summer↔winter10.3 °C

Max temp (day)13.2 °C 8.80–19.0

Min temp (night)7.60 °C 3.60–12.6

Precipitation148 mm/mo 79.4–310

Air humidity64.0 % 59.1–69.7

Moisture balance148 mm/mo

Vapour deficit436 Pa 340–638

Wind speed3.90 m/s

Cloud cover43.6 % 36.7–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)