Archytas metallicus

(Robineau-Desvoidy, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Archytas

At a glance

Occurrence records161

Data sources6

Biological traits0

DNA specimens29

eDNA detections51

Sources6 archives

Databases and archives Archytas metallicus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility161 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF161 records

Environmental DNA1 datasets · 2 countries51 detections

DNA & barcodingBOLD29 specimens

01Narrative

Archytas metallicus is a species of bristle fly in the family Tachinidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archytas metallicus has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections51

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

22Tmostly conserved

64Tmostly conserved

67Gmostly conserved

74Tmostly conserved

82Tmostly conserved

106Tmostly conserved

235Cmostly conserved

271Cmostly conserved

283Cmostly conserved

290Cmostly conserved

295Tmostly conserved

352Cmostly conserved

361Tmostly conserved

370Amostly conserved

373Gmostly conserved

376Gmostly conserved

391Amostly conserved

406Cmostly conserved

421Tmostly conserved

424Cmostly conserved

430Amostly conserved

439Amostly conserved

490Tmostly conserved

500Tmostly conserved

557Tmostly conserved

578Cmostly conserved

596Tmostly conserved

616Cmostly conserved

634Tmostly conserved

653Cmostly conserved

AACATTATATTTTATTTTTGGTGCATGATCTGGAATAGTAGGTACATCTTTAAGAATTTTAGTTCGGGCTGAATTAGGACATCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes7

BINs2

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archytas lateralissame genus5.6%Archytas californiaesame genus5.6%Archytas instabilissame genus5.8%Archytas diaphanussame genus6.1%Archytas apicifersame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type161 records

Wild obs. + sensor62

Museum / vouchered99

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 34≤1 km 13≤10 km 2>10 km 6

55 georeferenced · 7 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence99

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University Park, US	34
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
Lake Placid, US	16
University of Guelphlocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
CUlocation not on record	1
Ciudad de México, MX	1
US	1

8 institutions · 77 of 99 vouchered records shown · 22 without an institution code

09Environmental DNA51 detections

Where the DNA of Archytas metallicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map2 countries0

Temperate mixed forest1. Forest & WoodlandfenWetlandGrasslandMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 14.9–21.5

Seasonal swing summer↔winter28.5 °C

Max temp (day)22.9 °C 18.5–26.6

Min temp (night)14.7 °C 11.6–16.6

Precipitation93.3 mm/mo 75.9–119

Air humidity59.7 % 56.2–63.0

Moisture balance-40.3 mm/mo -63.5–16.1

Vapour deficit814 Pa 648–1,115

Wind speed2.70 m/s 2.10–5.90

Cloud cover43.4 % 31.3–53.1

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)