Archytas californiae

(Walker, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Archytas

At a glance

Occurrence records11

Data sources7

Biological traits0

DNA specimens34

eDNA detections34

Sources7 archives

Databases and archives Archytas californiae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF11 records

Environmental DNA1 datasets · 2 countries34 detections

DNA & barcodingBOLD34 specimens

01Narrative

Archytas californiae is a species of bristle fly in the family Tachinidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archytas californiae has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes1

eDNA detections34

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

43Avariable

46Avariable

82Tmostly conserved

118Tvariable

136Tvariable

202Gmostly conserved

235Cmostly conserved

290Cmostly conserved

298Tmostly conserved

301Tvariable

382Tvariable

397Tmostly conserved

401Cvariable

439Amostly conserved

595Cvariable

607Amostly conserved

613Tvariable

619Avariable

AACATTATATTTTATTTTTGGTGCATGATCCGGAATAGTAGGAACATCATTAAGAATTTTAGTCCGAGCTGAATTAGGACATCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes9

BINs2

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archytas diaphanussame genus2.4%Archytas apicifersame genus2.9%Archytas instabilissame genus4.6%Archytas marmoratussame genus4.9%Peleteria iteranssame family5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type11 records

Museum / vouchered11

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

10Collections & institutions

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
University of Guelphlocation not on record	2

2 institutions · 5 of 11 vouchered records shown · 6 without an institution code

09Environmental DNA34 detections

Where the DNA of Archytas californiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map2 countries0

Mixed habitatGrasslandSolidago sp.1. Forest & Woodland|1.4. Temperate ForestForest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 10.0–21.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)23.2 °C 16.7–26.5

Min temp (night)13.0 °C 3.70–17.4

Precipitation80.1 mm/mo 63.1–93.3

Air humidity58.3 % 52.8–59.6

Moisture balance-60.7 mm/mo -86.7–0.2

Vapour deficit903 Pa 566–1,065

Wind speed3.30 m/s 2.50–3.60

Cloud cover40.7 % 33.4–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)