Archytas marmoratus

(Townsend, 1915) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Archytas

At a glance

Occurrence records94

Data sources7

Biological traits0

DNA specimens22

eDNA detections14

Sources7 archives

Databases and archives Archytas marmoratus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD22 specimens

01Narrative

Archytas marmoratus, of the marmoratus species group, is a species of bristle fly in the family Tachinidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archytas marmoratus has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections14

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

24Amostly conserved

222Tmostly conserved

288Gmostly conserved

444Cmostly conserved

499Cmostly conserved

600Tmostly conserved

ACATTATATTTTATTTTCGGTGCATGATCTGGAATAGTAGGAACATCTCTTAGAATTTTAGTTCGAGCTGAATTAGGACATCCAGGAGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes3

BIN1

Most divergent pair0.30%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archytas diaphanussame genus4.7%Archytas instabilissame genus4.9%Archytas californiaesame genus4.9%Archytas apicifersame genus5.3%Protodejeania hystricosasame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor67

Museum / vouchered27

Range

Area of Occupancy AOO232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 30≤1 km 11≤10 km 1>10 km 10

52 georeferenced · 15 without coordinates

Open the mapobservation + sensor67

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 1≤1 km 3≤10 km 21

25 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
The University of the West Indies, Trinidad and Tobagolocation not on record	24
CUlocation not on record	1

2 institutions · 25 of 27 vouchered records shown · 2 without an institution code

09Environmental DNA14 detections

Where the DNA of Archytas marmoratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 24.1–26.7

Seasonal swing summer↔winter2.00 °C

Max temp (day)28.7 °C 27.5–29.6

Min temp (night)22.8 °C 20.9–24.1

Precipitation50.6 mm/mo 14.9–267

Air humidity63.3 % 60.0–67.2

Moisture balance-104 mm/mo -174–124

Vapour deficit1,068 Pa 1,033–1,386

Wind speed4.20 m/s 1.70–5.60

Cloud cover15.9 % 13.5–30.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)