Archirhoe neomexicana

(Hulst, 1896) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Archirhoe

At a glance

Occurrence records1 197

Data sources7

Biological traits0

DNA specimens5

eDNA detections0

Sources7 archives

Databases and archives Archirhoe neomexicana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 197 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 197 records

DNA & barcodingBOLD5 specimens

01Narrative

Archirhoe neomexicana is a species of geometrid moth in the family Geometridae. It is found in Central America and North America. The MONA or Hodges number for Archirhoe neomexicana is 7295.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archirhoe neomexicana has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

64Tmostly conserved

355Cmostly conserved

499Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCGGAATTAGGGAATCCCGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Capusa senilissame family7.1%Synopsidia phasidariasame family7.4%Crocypus perlucidariasame family7.6%Thalassodes immissariasame family7.8%Hulstina wrightiariasame family7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 197 records

Wild obs. + sensor631

Museum / vouchered566

Range

Area of Occupancy AOO2 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 336≤1 km 53≤10 km 28>10 km 77

494 georeferenced · 137 without coordinates

Open the mapobservation + sensor631

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 33≤1 km 63≤10 km 232>10 km 70

398 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence566

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	148
New Haven, US	111
Colorado State Universitylocation not on record	94
ASUlocation not on record	91
San Diego, US	59
East Lansing, US	20
US	13
Albuquerque, US	12
Milwaukee Public Museum (MPM)location not on record	5
Mississippi State, US	3
Ciudad de México, MX	3
Philadelphia, US	2
Santa Cruz, US	2
St. Paul, US	2
San Francisco, US	1

15 institutions · 566 of 566 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archirhoe neomexicana

At a glance

Sources7 archives

At a glance

Record type1 197 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 15 geolocated

Record type1 197 records