Archips negundana

(Dyar, 1902) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records83

Data sources8

Biological traits0

DNA specimens10

eDNA detections3

Sources8 archives

Databases and archives Archips negundana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility83 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF83 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD10 specimens

01Narrative

Archips negundana, the larger boxelder leafroller, is a moth of the family Tortricidae. The species was first described by Harrison Gray Dyar Jr. in 1902. It is found in North America from southern British Columbia to southern Quebec, south to California and Florida. Egg Larva Pupa Damage The wingspan is 18–21 mm. Adults are on wing in July. The larvae feed on Acer negundo, nettle Urtica, and honeysuckle Lonicera.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips negundana has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes2

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACATTATATTTTATTTTTGGTATCTGATCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips semiferanussame genus2.0%Archips magnolianasame genus4.9%Archips griseasame genus5.6%Archips crataeganasame genus5.6%Archips georgianasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type83 records

Wild obs. + sensor17

Museum / vouchered66

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 9≤1 km 2≤10 km 4>10 km 1

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 1≤10 km 3>10 km 3

7 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	29
Vernal, US	9
Washington, US	8
St. Paul, US	4
King Saud Universitylocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
East Lansing, US	3
Mississippi State, US	2
University of Alberta Museums (UAM)location not on record	2
Royal Saskatchewan Museumlocation not on record	2
Natural History Museum of Utahlocation not on record	1

11 institutions · 66 of 66 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Archips negundana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.3 °C 3.70–16.9

Seasonal swing summer↔winter33.5 °C

Max temp (day)13.9 °C 5.70–22.1

Min temp (night)7.50 °C 2.20–12.8

Precipitation47.9 mm/mo 27.7–68.1

Air humidity64.4 % 58.9–70.0

Vapour deficit557 Pa 274–839

Cloud cover55.2 % 43.6–66.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)