Archips georgiana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records332

Data sources7

Biological traits0

DNA specimens9

eDNA detections8

Sources7 archives

Databases and archives Archips georgiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility332 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF332 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Archips georgiana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1863 door Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips georgiana has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes2

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

34Tmostly conserved

100Tmostly conserved

268Amostly conserved

374Amostly conserved

484Tmostly conserved

493Gvariable

616Cmostly conserved

646Tvariable

TACATTATATTTTATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCATTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes3

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips argyrospilasame genus4.7%Archips magnolianasame genus4.9%Archips mortuanasame genus4.9%Archips eleagnanasame genus5.0%Archips griseasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type332 records

Wild obs. + sensor191

Museum / vouchered141

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 124≤1 km 23≤10 km 7>10 km 11

165 georeferenced · 26 without coordinates

Open the mapobservation + sensor191

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 63

63 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	76
Philadelphia, US	36
North Carolina State University Insect Museumlocation not on record	15
St. Paul, US	12
CUlocation not on record	1
Cornell University Insect Collectionlocation not on record	1

6 institutions · 141 of 141 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Archips georgiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 20.6–20.6

Seasonal swing summer↔winter23.5 °C

Max temp (day)26.1 °C

Min temp (night)16.1 °C

Precipitation146 mm/mo

Air humidity60.1 %

Moisture balance2.30 mm/mo

Vapour deficit968 Pa

Wind speed2.30 m/s

Cloud cover40.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)