Araschnia prorsoides

(Blanchard, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Araschnia

At a glance

Occurrence records51

Data sources7

Biological traits0

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Araschnia prorsoides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF51 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Araschnia prorsoides is a butterfly found in the East Palearctic (North India, Himalayas, West China, Manipur - North Burma) that belongs to the browns family.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araschnia prorsoides has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P622 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes2

BINs2

Most divergent pair3.1%

Where individuals differ — all 24 variable positions, in barcode order

60Tvariable

69Tvariable

72Cvariable

117Tmostly conserved

132Cmostly conserved

169Gmostly conserved

189Cmostly conserved

215Gmostly conserved

219Amostly conserved

254Gmostly conserved

256Gmostly conserved

258Tmostly conserved

261Amostly conserved

282Amostly conserved

291Cmostly conserved

312Tmostly conserved

315Tmostly conserved

318Tmostly conserved

357Cmostly conserved

448Amostly conserved

492Amostly conserved

496Tmostly conserved

579Tmostly conserved

591Tmostly conserved

TCTCTTAGTTTATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACAATTGTTACAGCTCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araschnia burejanasame genus3.4%Araschnia dorissame genus4.2%Araschnia levanasame genus4.6%Hypanartia godmaniisame family8.0%Antanartia deliussame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor39

Museum / vouchered12

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 6≤1 km 7≤10 km 9>10 km 11

33 georeferenced · 6 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 6

8 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	8
Durban Natural Science Museumlocation not on record	1
OSUClocation not on record	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1

4 institutions · 11 of 12 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Araschnia prorsoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 12.1–20.7

Seasonal swing summer↔winter20.0 °C

Max temp (day)13.8 °C 13.8–22.9

Min temp (night)8.60 °C 8.60–16.7

Precipitation159 mm/mo 159–161

Air humidity68.1 % 66.3–68.1

Moisture balance92.0 mm/mo 55.4–92.0

Vapour deficit501 Pa 501–879

Wind speed1.40 m/s 1.40–1.80

Cloud cover38.1 % 38.1–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)