Araschnia burejana

Bremer, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Araschnia

At a glance

Occurrence records2 143

Data sources8

Biological traits0

DNA specimens14

eDNA detections11

Sources8 archives

Databases and archives Araschnia burejana's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 143 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT2n = 62

01Narrative

Araschnia burejana, the large map, is a butterfly of the family Nymphalidae. It is found in Tibet, China, the Amur and Ussuri regions of Russia, Korea and Japan. It occurs in mixed forest up to 1,300 meters. Adults are on wing from May to June and from July to August in two generations per year.Russian Insects The larvae feed on Urtica species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araschnia burejana has left across the world's sequence archives.

At a glance

DNA specimens14

BINs4

Marker genes1

eDNA detections11

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 68 variable positions, in barcode order

40Amostly conserved

46Tmostly conserved

94Amostly conserved

95Amostly conserved

100Amostly conserved

106Cvariable

115Cmostly conserved

116Amostly conserved

118Tmostly conserved

120Cmostly conserved

122Amostly conserved

123Tmostly conserved

124Tmostly conserved

136Tmostly conserved

142Tmostly conserved

163Avariable

172Tmostly conserved

178Tmostly conserved

232Tmostly conserved

235Tmostly conserved

259Tmostly conserved

263Tmostly conserved

265Gvariable

266Cmostly conserved

278Tmostly conserved

283Cmostly conserved

298Tmostly conserved

301Amostly conserved

302Gmostly conserved

304Avariable

307Tmostly conserved

310Amostly conserved

313Cvariable

328Gvariable

337Tmostly conserved

355Tmostly conserved

361Cvariable

364Cvariable

370Tmostly conserved

382Tmostly conserved

385Tmostly conserved

386Tmostly conserved

388Amostly conserved

394Tmostly conserved

400Tmostly conserved

403Tmostly conserved

412Amostly conserved

427Tmostly conserved

436Tmostly conserved

445Tmostly conserved

466Amostly conserved

494Tvariable

499Amostly conserved

505Cmostly conserved

508Tmostly conserved

511Amostly conserved

523Tmostly conserved

538Tvariable

539Tmostly conserved

542Cvariable

574Tmostly conserved

580Tmostly conserved

581Tmostly conserved

583Amostly conserved

604Amostly conserved

625Amostly conserved

637Cmostly conserved

646Tmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes3

BINs4

Most divergent pair3.3%

AsiaOtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araschnia prorsoidessame genus3.4%Araschnia levanasame genus4.3%Araschnia dorissame genus5.1%Polygonia c-albumsame family8.5%Vanessa virginiensissame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Araschnia burejana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 62 n = 31

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 311×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 621×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 143 records

Wild obs. + sensor846

Museum / vouchered1 297

Range

Area of Occupancy AOO4 996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 129≤1 km 78≤10 km 25>10 km 33

265 georeferenced · 581 without coordinates

Open the mapobservation + sensor846

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 36≤10 km 25>10 km 22

83 georeferenced · 1 214 without coordinates

Open the institutions mapphysical evidence1 297

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Iwate Prefectural Museumlocation not on record	314
Tomioka, JP	127
Toyama, JP	80
Obihiro Centennial City Museumlocation not on record	69
Sanda, JP	66
RCMlocation not on record	64
Bando, JP	62
JP	60
KIRMlocation not on record	44
KOMlocation not on record	44
Toyota city nature sanctuarylocation not on record	40
Tokushima, JP	37
Kawasaki Shi Tama Ku, JP	26
Nagatoro-machi, Chichibu-gun, JP	26
Tartu, EE	24
Cambridge, US	23
Gifu prefectural Museumlocation not on record	23
Kushiro City Museumlocation not on record	22
Yokosuka City Museumlocation not on record	22
Yamaguchi-shi, JP	20
Oiso Municipal Museumlocation not on record	13
Sam Noble Oklahoma Museum of Natural Historylocation not on record	10
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	9
Natural History Museum of Utahlocation not on record	9
Sagamihara, JP	9
John May Museum of Natural Historylocation not on record	8
MZLUlocation not on record	8
NSMKlocation not on record	7
Saga Prefectural Space and Science Museumlocation not on record	7
New Haven, US	5
Zürich, CH	5
MJINlocation not on record	4
MJIMlocation not on record	4
HUNMlocation not on record	2
Philadelphia, US	1
Auckland, NZ	1

36 institutions · 1 295 of 1 297 vouchered records shown · 2 without an institution code

09Environmental DNA11 detections

Where the DNA of Araschnia burejana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 13.2–22.2

Seasonal swing summer↔winter27.3 °C

Max temp (day)22.4 °C 18.4–26.4

Min temp (night)12.0 °C 6.60–17.1

Precipitation98.6 mm/mo 47.7–162

Air humidity55.9 % 49.8–58.6

Moisture balance-38.0 mm/mo -72.3–18.2

Vapour deficit909 Pa 860–1,113

Wind speed3.00 m/s 2.60–3.90

Cloud cover44.1 % 32.1–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araschnia burejana

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 143 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 143 records