Araneus triguttatus

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records762

Data sources8

Biological traits14

DNA specimens9

eDNA detections47

Sources8 archives

Databases and archives Araneus triguttatus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility762 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

World Spider Trait DBMasaryk University14 traits · 22 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements22 literature sources14 traits

Occurrence & distributionGBIF762 records

Environmental DNA3 datasets · 6 countries47 detections

DNA & barcodingBOLD9 specimens

01Narrative

Araneus triguttatus (Synonym: Atea triguttata) ist eine Webspinne aus der Familie der Echten Radnetzspinnen (Araneidae), die der Schulterkreuzspinne (Araneus sturmi) sehr ähnlich ist.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 22 sources

Simonneau et al. 2016Macías-Hernández et al. 2020Buchar & Růžička 2002Harvey et al. 2017Staręga et al. 2001SLU 2020Henriksen & Hilmo 2015Bruun & Lissner 2019Liste France 2018Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Nentwig et al. 2018Cardoso et al. 2011

Morphometry6

Body length♀5.77·♂4.5 mm

Cephalothorax height0.364 mm

Cephalothorax length1.68 mm

Cephalothorax width1.5 mm

Fang length0.303 mm

Tibia I length1.5 mm

Predation1

Hunting guildorb web weavers

Ecology7

Ballooningyes

Circadian activity0 mm

Light 2shaded

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categorySave or at low risk (SA)

Stratum1 mm

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus triguttatus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections47

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

4Gmostly conserved

79Gmostly conserved

199Amostly conserved

340Tvariable

574Tmostly conserved

TACGTTATATTTAGTGTTTGGGGCATGAGCTGCAATAGTGGGGACTGCTATAAGAGTATTGATTCGAGTTGAGTTAGGGCAGTCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes5

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoscona subfuscasame family11.2%Cyclosa walckenaerisame family11.2%Neoscona arabescasame family11.6%Araneus nubososame genus11.7%Araneus saevussame genus11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type762 records

Wild obs. + sensor627

Museum / vouchered134

Other1

Origin

Native54

Range

Area of Occupancy AOO2 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 153≤1 km 87≤10 km 261>10 km 10

511 georeferenced · 116 without coordinates

Open the mapobservation + sensor627

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 6≤1 km 10≤10 km 38>10 km 1

55 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	18
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	13
SNSDlocation not on record	10
Bern, CH	6
Bonn, DE	5
SLU Artdatabankenlocation not on record	5
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	3
Zoologisches Museum Hamburglocation not on record	3
Tilburg, NL	3
	3
ZSMlocation not on record	2
Ekaterinburg, RU	2
Helsinki, FI	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Uniwersytet w Białymstokulocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1

17 institutions · 83 of 134 vouchered records shown · 51 without an institution code

09Environmental DNA47 detections

Where the DNA of Araneus triguttatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys3

Countries6

Verifiable raw sequence linked36

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map6 countries0

HalbtrockenrasenWaldrand an Wiese,in krautiger Randvegetation

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.6 °C 3.40–16.8

Seasonal swing summer↔winter16.9 °C

Max temp (day)14.2 °C 6.00–20.2

Min temp (night)6.80 °C 0.4–13.5

Precipitation60.8 mm/mo 37.2–78.6

Air humidity62.3 % 58.7–67.2

Moisture balance-9.40 mm/mo -58.8–34.7

Vapour deficit517 Pa 259–724

Wind speed4.20 m/s 2.50–5.00

Cloud cover45.2 % 39.8–56.2

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)