Araneus sturmi

(Hahn, 1831) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records3 991

Data sources9

Biological traits15

DNA specimens33

eDNA detections844

Sources9 archives

Databases and archives Araneus sturmi's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 991 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI844 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

World Spider Trait DBMasaryk University15 traits · 23 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements23 literature sources15 traits

Occurrence & distributionGBIF3 991 records

Environmental DNA4 datasets · 12 countries844 detections

DNA & barcodingBOLD33 specimens

01Narrative

miniatur|Eine Schulterkreuzspinne in ihrem Netz Die Schulterkreuzspinne (Araneus sturmi) ist eine Webspinne aus der Familie der Echten Radnetzspinnen (Araneidae).

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 23 sources

Birkhofer et al. 2017Macías-Hernández et al. 2020Buchar & Růžička 2002Staręga et al. 2001SLU 2020Bruun & Lissner 2019Hyvärinen et al. 2019Liste France 2018Harvey et al. 2017Henriksen & Hilmo 2015Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Kielhorn 2017Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Finch 2004Nentwig et al. 2018Cardoso et al. 2011

Morphometry6

Body length♀3.89·♂3.7 mm

Cephalothorax height♀0.318·♂0.273 mm

Cephalothorax length♀1.5·♂1.66 mm

Cephalothorax width♀1.27·♂1.43 mm

Fang length♀0.197·♂0.22 mm

Tibia I length♀1.32·♂1.52 mm

Predation2

Hunting guildorb web weavers

Simple hunting guild classificationweb-building

Ecology7

Ballooninghigh

Circadian activity0.45 mm

Light 2partly shaded

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (lc)

Regional non-IUCN Red List categorySave or at low risk (SA)

Stratum0.83 mm

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus sturmi has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections844

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

43Tmostly conserved

58Amostly conserved

214Gmostly conserved

256Cmostly conserved

280Gmostly conserved

290Amostly conserved

337Cmostly conserved

430Amostly conserved

442Cmostly conserved

553Gmostly conserved

GACATTATATTTGGTATTTGGGGCATGGGCTGCTATGGTGGGTACTGCTATAAGAGTATTGATTCGGGTAGAATTAGGACAATCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes10

BIN1

Most divergent pair1.5%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araneus triguttatussame genus11.9%Neoscona subfuscasame family13.2%Neoscona arabescasame family13.5%Wagneriana lechuzasame family14.0%Phonognatha graeffeisame family15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 991 records

Wild obs. + sensor3 083

Museum / vouchered893

Cultivated / captive2

Other13

Origin

Native33

Range

Area of Occupancy AOO9 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 1 058≤1 km 943≤10 km 809>10 km 21

2 831 georeferenced · 252 without coordinates

Open the mapobservation + sensor3 083

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 133≤1 km 103≤10 km 277>10 km 41

554 georeferenced · 339 without coordinates

Open the institutions mapphysical evidence893

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	379
SLU Artdatabankenlocation not on record	46
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	37
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	26
Ekaterinburg, RU	25
Copenhagen, DK	15
Adam Mickiewicz University in Poznańlocation not on record	15
Tartu, EE	14
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	12
Bonn, DE	12
Frankfurt am Main	11
	8
Uniwersytet w Białymstokulocation not on record	7
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	6
Paro, BT	6
Akademia Pomorska w Słupskulocation not on record	5
Prioksko-Terrasnyi Biosphere Reservelocation not on record	5
Bern, CH	4
BioFokuslocation not on record	4
Washington, US	3
Liverpool, GB	3
ZSMlocation not on record	2
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Tilburg, NL	2
RMZlocation not on record	2
Zoologisches Museum Hamburglocation not on record	2
MZLUlocation not on record	2
NTNU-VMlocation not on record	1
SNSDlocation not on record	1
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1
SGAV-and-NHMDlocation not on record	1
neflocation not on record	1

34 institutions · 663 of 893 vouchered records shown · 230 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA844 detections

Where the DNA of Araneus sturmi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found844

Studies independent surveys4

Countries12

Verifiable raw sequence linked808

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 844 detections have coordinates

Open the map12 countries0

Regenmoor-ReliktflÃ¤chetrail from Socerb to OspRiparian forestwnetrze domuUrban pine forestNadelforst auf Nadelzweigen

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 5.70–16.0

Seasonal swing summer↔winter19.5 °C

Max temp (day)15.7 °C 9.50–19.9

Min temp (night)8.90 °C 2.10–12.8

Precipitation66.5 mm/mo 42.2–94.3

Air humidity60.5 % 56.9–65.6

Moisture balance-21.3 mm/mo -60.2–32.6

Vapour deficit591 Pa 343–725

Wind speed2.90 m/s 2.30–4.10

Cloud cover48.5 % 41.5–56.2

CHELSA 1981–2010, ~9 km grid, at location & month of 843 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araneus sturmi

At a glance

Sources9 archives

Morphometry6

Predation2

Ecology7

At a glance

Record type3 991 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 991 records