Araneus grossus

(C.L.Koch, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records391

Data sources8

Biological traits11

DNA specimens3

eDNA detections0

Sources8 archives

Databases and archives Araneus grossus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility391 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

World Spider Trait DBMasaryk University11 traits · 8 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements8 literature sources11 traits

Occurrence & distributionGBIF391 records

DNA & barcodingBOLD3 specimens

01Narrative

Araneus grossus is a orb-weaver spider species. The species is one of the largest orb-weaver spiders in Europe. It is found in South and Southeast Europe and Central Asia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesMacías-Hernández et al. 2020LGBl 2007LGBl 2015Ministerial Decree 2001Gajdoš & Svatoň 2001Gajdoš et al. 2014Komposch & Steinberger 1999Noflatscher 1994

Morphometry6

Body length9.43 mm

Cephalothorax height1.14 mm

Cephalothorax length4.86 mm

Cephalothorax width4.43 mm

Fang length0.727 mm

Tibia I length5.57 mm

Ecology5

Circadian activity1 mm

Legal protectionYes

Regional IUCN Red List categoryNear Threatened (NT)

Regional non-IUCN Red List categoryEndangered (2)

Stratum1 mm

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus grossus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

103Tvariable

160Avariable

220Cvariable

319Avariable

343Gvariable

458Avariable

536Cvariable

562Avariable

616Tvariable

AACTTTGTATTTAATTTTTGGGGCTTGAGCAGCAATAGTAGGAACTGCAATAAGAGTATTAATTCGAATTGAATTAGGACAGCCAGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes3

BIN1

Most divergent pair1.2%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araneus angulatussame genus11.1%Araneus ventricosussame genus11.4%Araneus circesame genus11.6%Cyclosa insulanasame family12.6%Cyclosa perkinsisame family12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type391 records

Wild obs. + sensor361

Museum / vouchered29

Other1

Range

Area of Occupancy AOO1 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 109≤1 km 33≤10 km 86>10 km 10

238 georeferenced · 123 without coordinates

Open the mapobservation + sensor361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 4≤10 km 7

11 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	5
Ekaterinburg, RU	4
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
	1
Frankfurt am Main	1

5 institutions · 12 of 29 vouchered records shown · 12 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)