Araneus circe

(Audouin, 1826) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records358

Data sources7

Biological traits3

DNA specimens11

eDNA detections0

Sources7 archives

Databases and archives Araneus circe's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility358 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

World Spider Trait DBMasaryk University3 traits · 5 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources3 traits

Occurrence & distributionGBIF358 records

DNA & barcodingBOLD11 specimens

01Narrative

Araneus circe is an orb-weaving spider species with a Palearctic distribution.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014aGajdoš et al. 2014Gajdoš & Svatoň 2001Komposch & Steinberger 1999Noflatscher 1994

Ecology3

Circadian activitynocturnal

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryExtremely Rare (R)

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus circe has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

7Amostly conserved

10Cmostly conserved

109Gmostly conserved

166Gmostly conserved

178Cmostly conserved

199Gmostly conserved

212Tmostly conserved

217Gmostly conserved

220Tmostly conserved

223Gmostly conserved

271Tmostly conserved

278Tmostly conserved

294Cmostly conserved

302Amostly conserved

346Amostly conserved

407Tmostly conserved

475Tmostly conserved

478Amostly conserved

499Tmostly conserved

545Tmostly conserved

571Tmostly conserved

589Cmostly conserved

610Tmostly conserved

616Tmostly conserved

622Amostly conserved

649Gmostly conserved

652Cmostly conserved

655Gmostly conserved

AACTTTATACTTAATTTTTGGTGCTTGGGCTGCTATGGTAGGAACTGCAATAAGAGTATTAATTCGAATTGAATTGGGTCAGCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes8

BINs2

Most divergent pair3.2%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araneus angulatussame genus8.7%Araneus andrewsisame genus11.2%Araneus grossussame genus11.6%Araneus ventricosussame genus11.7%Neoscona nauticasame family11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type358 records

Wild obs. + sensor301

Museum / vouchered56

Other1

Origin

Native10

Range

Area of Occupancy AOO1 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 115≤1 km 41≤10 km 72>10 km 13

241 georeferenced · 60 without coordinates

Open the mapobservation + sensor301

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	2
	2
Bonn, DE	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Frankfurt am Main	1

6 institutions · 8 of 56 vouchered records shown · 48 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)