Araeopidius monachus

(LeConte, 1874) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Ptilodactylidae/Araeopidius

At a glance

Occurrence records120

Data sources6

Biological traits0

DNA specimens8

eDNA detections3

Sources6 archives

Databases and archives Araeopidius monachus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility120 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF120 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD8 specimens

01Narrative

Araeopidius monachus is een keversoort uit de familie Ptilodactylidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1874 door LeConte.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araeopidius monachus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)3.1%

Haplotypes1

BIN1

Where individuals differ — all 51 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

13Tmostly conserved

14Amostly conserved

16Cmostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

24Cmostly conserved

25Cmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

38Cmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Tmostly conserved

44Amostly conserved

45Tmostly conserved

46Amostly conserved

47Gmostly conserved

48Cmostly conserved

49Cmostly conserved

50Tmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Cmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Cmostly conserved

75Tmostly conserved

AACATTATATTTTATCTTAGGATCCTGATCAGGAATACTAGGTATAGCCTTAAGACTATTAATTCGTGCAGAACTAGGAAGACCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleochara moerenssame order14.4%Aleochara pacificasame order15.3%Aleochara latasame order15.7%Scathophaga obscurinervissame order16.1%Somula decorasame order16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type120 records

Wild obs. + sensor44

Museum / vouchered76

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 17≤1 km 11≤10 km 3

31 georeferenced · 13 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 12≤1 km 1≤10 km 3

16 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	40
Chicago, US	16
Edmonton, CA	14
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	1
Lexington, US	1

6 institutions · 74 of 76 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Araeopidius monachus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)