Aradus cinnamomeus

Panzer, 1806 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aradidae/Aradus

At a glance

Occurrence records1 638

Data sources7

Biological traits1

DNA specimens28

eDNA detections25

Sources7 archives

Databases and archives Aradus cinnamomeus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 638 records

Environmental DNA3 datasets · 5 countries25 detections

DNA & barcodingBOLD28 specimens

01Narrative

miniatur|Männchen und Weibchen (rechts) bei der Paarung und ein weiteres Männchen Die Kiefernrindenwanze (Aradus cinnamomeus) ist eine Wanzenart aus der Familie der Rindenwanzen (Aradidae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)xylophagous

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aradus cinnamomeus has left across the world's sequence archives.

At a glance

DNA specimens28

BINs3

Marker genes1

eDNA detections25

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 122 variable positions, in barcode order

5Tmostly conserved

70Amostly conserved

74Cmostly conserved

78Cmostly conserved

85Amostly conserved

88Amostly conserved

91Cmostly conserved

94Gmostly conserved

101Amostly conserved

103Tmostly conserved

112Cmostly conserved

122Gmostly conserved

124Amostly conserved

127Tmostly conserved

130Tmostly conserved

131Gvariable

136Cmostly conserved

139Amostly conserved

145Tmostly conserved

151Cmostly conserved

154Tmostly conserved

157Cmostly conserved

169Tmostly conserved

172Tmostly conserved

181Amostly conserved

190Amostly conserved

197Cmostly conserved

205Cmostly conserved

206Cmostly conserved

214Cmostly conserved

217Gmostly conserved

232Cmostly conserved

247Tmostly conserved

250Tmostly conserved

263Amostly conserved

266Tmostly conserved

268Gvariable

271Cmostly conserved

278Amostly conserved

284Amostly conserved

286Amostly conserved

287Amostly conserved

289Amostly conserved

290Amostly conserved

293Gmostly conserved

295Gvariable

298Amostly conserved

301Tmostly conserved

304Gmostly conserved

337Amostly conserved

340Cmostly conserved

343Cmostly conserved

346Tmostly conserved

349Amostly conserved

361Cmostly conserved

364Cmostly conserved

367Tmostly conserved

376Amostly conserved

388Tmostly conserved

390Tmostly conserved

400Gmostly conserved

401Tmostly conserved

407Tmostly conserved

409Amostly conserved

412Tmostly conserved

415Amostly conserved

418Amostly conserved

421Amostly conserved

427Cmostly conserved

428Tmostly conserved

430Amostly conserved

433Gmostly conserved

436Amostly conserved

439Amostly conserved

451Amostly conserved

454Gmostly conserved

460Amostly conserved

463Cmostly conserved

469Cmostly conserved

472Amostly conserved

473Gmostly conserved

474Amostly conserved

478Cvariable

483Amostly conserved

484Amostly conserved

485Cmostly conserved

487Amostly conserved

491Amostly conserved

496Tmostly conserved

499Cmostly conserved

500Cmostly conserved

523Tmostly conserved

530Amostly conserved

532Cmostly conserved

533Cmostly conserved

535Amostly conserved

536Cmostly conserved

538Tmostly conserved

539Cmostly conserved

542Tmostly conserved

548Tmostly conserved

550Amostly conserved

562Gmostly conserved

565Amostly conserved

568Cmostly conserved

574Amostly conserved

578Cmostly conserved

586Cmostly conserved

592Tmostly conserved

595Tmostly conserved

616Cmostly conserved

619Cmostly conserved

628Gvariable

631Gmostly conserved

634Cmostly conserved

637Cmostly conserved

638Gmostly conserved

641Cmostly conserved

649Amostly conserved

652Cmostly conserved

+2 more variable positions not shown

CACATTATATTTTATGCTAGGAATATGATCAGGAATACTAGGAACATCAATAAGACTAATAATCCGAATAGAACTAGCACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes3

BINs3

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aradus signaticornissame genus16.0%Aradus betulinussame genus16.5%Aradus krueperisame genus16.7%Anthocoris amplicollissame order17.3%Phytocoris heidemannisame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 638 records

Wild obs. + sensor947

Museum / vouchered645

Other46

Range

Area of Occupancy AOO3 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 317≤1 km 173≤10 km 327>10 km 40

857 georeferenced · 90 without coordinates

Open the mapobservation + sensor947

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 123≤1 km 67≤10 km 97>10 km 1

288 georeferenced · 357 without coordinates

Open the institutions mapphysical evidence645

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	292
Jyväskylä, FI	82
NHMOlocation not on record	59
SLU Artdatabankenlocation not on record	38
Philadelphia, US	21
Metsähallituslocation not on record	21
Bonn, DE	15
Vancouver, CA	8
ZMAAlocation not on record	8
BioFokuslocation not on record	4
MZLUlocation not on record	4
Tartu, EE	3
Bavarian State Collection of Zoologylocation not on record	3
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
Helsinki, FI	2
Tallinn, EE	2
Kuopio, FI	2
ZSMlocation not on record	2
Ugentlocation not on record	2
Natural History Museum Rotterdamlocation not on record	1

20 institutions · 571 of 645 vouchered records shown · 74 without an institution code

09Environmental DNA25 detections

Where the DNA of Aradus cinnamomeus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys3

Countries5

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map5 countries0

Hay meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C -4.80–17.2

Seasonal swing summer↔winter18.9 °C

Max temp (day)18.1 °C -2.80–18.9

Min temp (night)10.0 °C -7.50–14.9

Precipitation65.3 mm/mo 55.2–95.2

Air humidity62.2 % 59.1–73.8

Moisture balance-8.90 mm/mo -65.8–49.5

Vapour deficit593 Pa 119–728

Wind speed3.80 m/s 2.30–5.50

Cloud cover43.8 % 38.3–60.0

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aradus cinnamomeus

At a glance

Sources7 archives

Diet & foraging1

At a glance

Record type1 638 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 638 records