Arachnospila trivialis

(Dahlbom, 1843) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pompilidae/Arachnospila

At a glance

Occurrence records5 085

Data sources7

Biological traits0

DNA specimens49

eDNA detections17

Sources7 archives

Databases and archives Arachnospila trivialis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 085 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 085 records

Environmental DNA3 datasets · 6 countries17 detections

DNA & barcodingBOLD49 specimens

01Narrative

Arachnospila trivialis is a widespread spider wasp of sandy soil areas of the Palaearctic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachnospila trivialis has left across the world's sequence archives.

At a glance

DNA specimens49

BINs4

Marker genes2

eDNA detections17

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P628 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Diversity (π)7.9%

Haplotypes1

BINs3

Where individuals differ — all 133 variable positions, in barcode order

46Gmostly conserved

61Avariable

64Cvariable

67Gvariable

70Avariable

74Cvariable

76Gvariable

88Amostly conserved

109Avariable

163Avariable

181Avariable

199Avariable

214Gmostly conserved

235Cvariable

271Tmostly conserved

292Avariable

293Tmostly conserved

298Tvariable

305Gmostly conserved

310Gvariable

316Gmostly conserved

322Avariable

367Gmostly conserved

370Avariable

385Cvariable

418Amostly conserved

421Tmostly conserved

424Cmostly conserved

430Avariable

454Gmostly conserved

469Tvariable

471Gmostly conserved

472Avariable

473Gmostly conserved

474Tmostly conserved

475Tmostly conserved

476Tmostly conserved

477Cmostly conserved

478Amostly conserved

479Tmostly conserved

482Gmostly conserved

483Amostly conserved

484Tmostly conserved

485Amostly conserved

486Amostly conserved

487Gmostly conserved

489Tmostly conserved

490Gmostly conserved

492Cmostly conserved

493Tvariable

494Tmostly conserved

497Tmostly conserved

498Tmostly conserved

501Gmostly conserved

502Tmostly conserved

504Gmostly conserved

505Avariable

507Cmostly conserved

508Avariable

509Gmostly conserved

510Tmostly conserved

511Tmostly conserved

513Tmostly conserved

514Amostly conserved

515Amostly conserved

518Amostly conserved

519Cmostly conserved

520Gmostly conserved

521Gmostly conserved

522Cmostly conserved

524Avariable

525Tmostly conserved

526Tmostly conserved

527Tmostly conserved

528Tmostly conserved

529Amostly conserved

530Tmostly conserved

532Amostly conserved

540Cmostly conserved

541Tmostly conserved

545Cmostly conserved

548Gmostly conserved

550Tmostly conserved

551Tmostly conserved

552Tmostly conserved

553Amostly conserved

555Cmostly conserved

557Gmostly conserved

558Gmostly conserved

559Tmostly conserved

562Amostly conserved

563Amostly conserved

564Tmostly conserved

566Amostly conserved

568Gvariable

571Amostly conserved

572Tmostly conserved

573Tmostly conserved

574Gvariable

575Tmostly conserved

579Cmostly conserved

580Tmostly conserved

581Gmostly conserved

582Amostly conserved

583Tmostly conserved

584Cmostly conserved

585Gmostly conserved

587Amostly conserved

590Tmostly conserved

591Tmostly conserved

596Amostly conserved

597Cmostly conserved

598Amostly conserved

600Cmostly conserved

602Tmostly conserved

603Tmostly conserved

604Tmostly conserved

605Tmostly conserved

606Tmostly conserved

608Cmostly conserved

+13 more variable positions not shown

TACATTATATTTTTTATTTGGTATGTGAGCAGGTACAATAGGTACGTCTTTAAGTTTATTAATCCGGGTAGAGCTGGGAAGTGCAGGACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammosphex michiganensissame family6.0%Arachnospila michiganensissame genus9.8%Arachnospila ancepssame genus10.5%Ammosphex luctuosussame family10.9%Arachnospila hedickeisame genus12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S-D2

animal barcodemarker

08Occurrence & distribution

Record type5 085 records

Wild obs. + sensor3 134

Museum / vouchered1 951

Range

Area of Occupancy AOO6 528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 2 510≤1 km 376≤10 km 198

3 084 georeferenced · 50 without coordinates

Open the mapobservation + sensor3 134

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 765≤1 km 523≤10 km 309>10 km 20

1 617 georeferenced · 334 without coordinates

Open the institutions mapphysical evidence1 951

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	640
Provincia di Livornolocation not on record	292
Helsinki, FI	199
Philadelphia, US	179
Zürich, CH	140
Stockholm, SE	78
NHMOlocation not on record	63
Metsähallituslocation not on record	58
ZMAAlocation not on record	43
Trondheim, NO	39
Bonn, DE	25
Natural History Museum Rotterdamlocation not on record	21
South Kensington, GB	18
ZSMlocation not on record	17
BioFokuslocation not on record	12
Bavarian State Collection of Zoologylocation not on record	11
Tartu, EE	5
neflocation not on record	5
CBDClocation not on record	4
NMOKlocation not on record	4
NCMGlocation not on record	2
US	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
UGRlocation not on record	1
Gothenburg, SE	1

25 institutions · 1 859 of 1 951 vouchered records shown · 92 without an institution code

09Environmental DNA17 detections

Where the DNA of Arachnospila trivialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys3

Countries6

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 11.7–19.0

Seasonal swing summer↔winter18.4 °C

Max temp (day)19.2 °C 15.5–23.5

Min temp (night)13.0 °C 6.60–14.2

Precipitation67.6 mm/mo 54.6–119

Air humidity59.5 % 57.3–61.6

Moisture balance-48.2 mm/mo -63.2–-13.3

Vapour deficit728 Pa 552–940

Wind speed3.20 m/s 2.50–4.30

Cloud cover41.0 % 30.0–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arachnospila trivialis

At a glance

Sources7 archives

At a glance

Record type5 085 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 085 records