Arachnospila anceps

(Wesmael, 1851) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pompilidae/Arachnospila

At a glance

Occurrence records7 824

Data sources7

Biological traits0

DNA specimens49

eDNA detections61

Sources7 archives

Databases and archives Arachnospila anceps's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 824 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI61 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 824 records

Environmental DNA3 datasets · 3 countries61 detections

DNA & barcodingBOLD49 specimens

01Narrative

Arachnospila anceps is one of the more common spider wasps of western Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachnospila anceps has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes2

eDNA detections61

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.2%

Haplotypes1

BIN1

Where individuals differ — all 18 variable positions, in barcode order

25Gvariable

34Avariable

36Cmostly conserved

37Amostly conserved

40Gmostly conserved

94Cvariable

184Gmostly conserved

298Amostly conserved

343Avariable

376Amostly conserved

391Gmostly conserved

430Amostly conserved

463Avariable

469Avariable

490Avariable

505Avariable

608Cmostly conserved

609Tmostly conserved

TACATTGTATTTTTTGTTTGGTATGTGGGCAGGAACAATGGGGACATCTTTAAGATTATTAATTCGTGTAGAATTAGGAAGAGCAGGACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammosphex michiganensissame family10.2%Ammosphex luctuosussame family10.5%Arachnospila trivialissame genus10.5%Arachnospila michiganensissame genus10.8%Arachnospila hedickeisame genus12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S-D2

animal barcodemarker

08Occurrence & distribution

Record type7 824 records

Wild obs. + sensor4 956

Museum / vouchered2 862

Other6

Range

Area of Occupancy AOO10 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 3 706≤1 km 611≤10 km 452>10 km 3

4 772 georeferenced · 184 without coordinates

Open the mapobservation + sensor4 956

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 1 137≤1 km 637≤10 km 251>10 km 27

2 052 georeferenced · 810 without coordinates

Open the institutions mapphysical evidence2 862

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	856
Philadelphia, US	564
Provincia di Livornolocation not on record	344
Stockholm, SE	198
Helsinki, FI	194
NHMOlocation not on record	84
Metsähallituslocation not on record	75
Zürich, CH	69
ZMAAlocation not on record	60
Trondheim, NO	51
Natural History Museum Rotterdamlocation not on record	47
ZSMlocation not on record	24
Bavarian State Collection of Zoologylocation not on record	16
Bonn, DE	16
BioFokuslocation not on record	15
Uniwersytet Łódzkilocation not on record	14
Muzeum Górnośląskie w Bytomiulocation not on record	11
neflocation not on record	10
Tartu, EE	5
Paris, FR	5
NCMGlocation not on record	5
European Distributed Institute of Taxonomy (EDIT)location not on record	4
CBDClocation not on record	4
US	4
Gothenburg, SE	3
South Kensington, GB	3
Tromsø, NO	2
MNHWlocation not on record	2
DFlocation not on record	1
Royal Alberta Museum, Invertebrate Zoologylocation not on record	1
IMEDEAlocation not on record	1

31 institutions · 2 688 of 2 862 vouchered records shown · 174 without an institution code

09Environmental DNA61 detections

Where the DNA of Arachnospila anceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found61

Studies independent surveys3

Countries3

Verifiable raw sequence linked59

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 61 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.6–17.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.0 °C 17.6–21.2

Min temp (night)12.5 °C 9.40–13.9

Precipitation76.0 mm/mo 57.1–103

Air humidity60.5 % 58.0–62.5

Moisture balance-38.2 mm/mo -62.7–-1.70

Vapour deficit724 Pa 629–798

Wind speed3.50 m/s 2.30–4.20

Cloud cover49.5 % 39.9–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arachnospila anceps

At a glance

Sources7 archives

At a glance

Record type7 824 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 824 records