Apteronotus apurensis

Fernández-Yépez, 1968 · species

image placeholder — illustration coming later

Animalia/Chordata/Gymnotiformes/Apteronotidae/Apteronotus

At a glance

Occurrence records56

Data sources7

Biological traits4

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Apteronotus apurensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF56 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Apteronotus apurensis is een straalvinnige vissensoort uit de familie van de staartvinmesalen (Apteronotidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1968 door Fernández-Yépez.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length30.8 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability20.8

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apteronotus apurensis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P490 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

34Cmostly conserved

97Gmostly conserved

106Tmostly conserved

118Amostly conserved

142Amostly conserved

151Gmostly conserved

160Gmostly conserved

184Amostly conserved

208Cmostly conserved

217Cmostly conserved

226Cmostly conserved

238Amostly conserved

247Gmostly conserved

253Amostly conserved

265Amostly conserved

274Tmostly conserved

277Cmostly conserved

310Amostly conserved

352Tmostly conserved

373Cmostly conserved

388Gmostly conserved

394Cmostly conserved

403Amostly conserved

406Tmostly conserved

415Amostly conserved

433Avariable

439Amostly conserved

463Gmostly conserved

478Tmostly conserved

TCAACCAGGCACCCTCCTAGAAGACGACCAAATCTACAATGTAGCCGTCACTGCCCATGCCTTCGTAATAATTTTCTTTATAGTTATGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes3

BINs2

Most divergent pair5.7%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Porotergus gymnotussame family5.7%Apteronotus bonapartiisame genus6.7%Apteronotus ellisisame genus7.3%Sternarchogiton porcinumsame family7.6%Porotergus gimbelisame family8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type56 records

Wild obs. + sensor3

Museum / vouchered53

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤1 km 13≤10 km 1>10 km 1

15 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad del Tolima (UT)location not on record	14
Chicago, US	8
Universidad de los Llanos (UniLlanos)location not on record	7
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	6
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	5
Ann Arbor, US	3
Montgomery, US	2
University of Nebraskalocation not on record	2
Champaign, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
Toronto, CA	1
	1

13 institutions · 53 of 53 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Apteronotus apurensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)