Apotolype blanchardi

Franclemont, 1973 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lasiocampidae/Apotolype

At a glance

Occurrence records93

Data sources5

Biological traits0

DNA specimens79

eDNA detections69

Sources5 archives

Databases and archives Apotolype blanchardi's data was compiled from.

GBIFGlobal Biodiversity Information Facility93 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics79 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF93 records

Environmental DNA1 datasets · 2 countries69 detections

DNA & barcodingBOLD79 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding79 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotolype blanchardi has left across the world's sequence archives.

At a glance

DNA specimens79

BINs3

Marker genes1

eDNA detections69

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

169Tmostly conserved

190Gmostly conserved

268Avariable

409Gmostly conserved

520Amostly conserved

562Amostly conserved

583Amostly conserved

589Tvariable

622Tmostly conserved

625Tmostly conserved

628Amostly conserved

634Tvariable

AACTTTATATTTTTTTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGGACTCCTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes11

BINs3

Most divergent pair15.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotolype brevicristasame genus4.6%Tolype caietasame family7.6%Nemoria festariasame order8.7%Pelatea klugianasame order9.0%Nemoria saturibasame order9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type93 records

Wild obs. + sensor40

Museum / vouchered53

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 19≤1 km 4≤10 km 5>10 km 4

32 georeferenced · 8 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	39
Smithsonian Institution, National Museum of Natural Historylocation not on record	8
Tapachula, MX	4
Area de Conservacion Guanacastelocation not on record	1
East Lansing, US	1

5 institutions · 53 of 53 vouchered records shown

09Environmental DNA69 detections

Where the DNA of Apotolype blanchardi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 24.8–26.2

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.9 °C 26.7–29.2

Min temp (night)23.4 °C 22.3–24.2

Precipitation151 mm/mo 4.90–333

Air humidity65.5 % 59.7–69.9

Moisture balance9.50 mm/mo -184–249

Vapour deficit1,176 Pa 939–1,334

Wind speed3.30 m/s 1.70–5.70

Cloud cover30.6 % 13.3–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 66 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)