Apostichopus leukothele

(Lambert, 1986) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Synallactida/Stichopodidae/Apostichopus

At a glance

Occurrence records2 643

Data sources9

Biological traits2

DNA specimens7

eDNA detections0

Sources9 archives

Databases and archives Apostichopus leukothele's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility993 records↗

OBISOcean Biodiversity Information System1 650 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS2 643 records

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · NCBI≈500 Mbp

01Narrative

Apostichopus leukothele is een zeekomkommer uit de familie Stichopodidae. De wetenschappelijke naam van de soort werd in 1986 gepubliceerd door Philip Lambert.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apostichopus leukothele has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P841 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.24%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

340Cvariable

391Avariable

574Avariable

TACACTCTACTTAATTTTTGGAGCATGAGCAGGAATGGCTGGAACAGCCATGAGTGTTATCATTCGGACAGAACTGGCCCAACCAGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apostichopus californicussame genus2.3%Apostichopus japonicussame genus10.4%Parastichopus tremulussame family16.4%Holothuria spiniferasame order17.2%Australostichopus mollissame family17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apostichopus leukothele carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈500 183 690 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apostichopus leukothele0.50 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness45.8% BUSCO

08Occurrence & distribution

Record type2 643 records

Wild obs. + sensor2 627

Museum / vouchered16

Range

Area of Occupancy AOO3 648 km²

Depth

0–200 m sunlit556

200–1000 m twilight185

1–4 km midnight0

>4 km abyssal0

median 171.8 m · max 481.5 m · 741 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 8≤10 km 4>10 km 2

14 georeferenced · 2 613 without coordinates

Open the mapobservation + sensor2 627

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 16 records without

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Cambridge, US	2
Paris, FR	1
Victoria, CA	1
Florida Museum of Natural Historylocation not on record	1
Washington, US	1

6 institutions · 9 of 16 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apostichopus leukothele

At a glance

Sources9 archives

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 643 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 6 geolocated

Record type2 643 records