Apostichopus japonicus

(Selenka, 1867) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Synallactida/Stichopodidae/Apostichopus

At a glance

Occurrence records896

Data sources14

Biological traits6

DNA specimens142

eDNA detections141

Sources14 archives

Databases and archives Apostichopus japonicus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility516 records↗

OBISOcean Biodiversity Information System380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI141 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics142 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF · OBIS896 records

Environmental DNA3 datasets · 5 countries141 detections

DNA & barcodingBOLD142 specimens

Genome at a glanceGoaT · NCBI≈703 Mbp

01Narrative

Apostichopus japonicus is a species of sea cucumber in the family Stichopodidae. It is found in shallow temperate waters along the coasts of south east Asia and is commonly known as the Japanese spiky sea cucumber or the Japanese sea cucumber.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length30 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max200 m

Depth min0 m

03Chemical composition26 compounds

Compounds documented for Apostichopus japonicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cholestane steroids4

Isocomane sesquiterpenoids2

Germacrane sesquiterpenoids1

Neutral glycosphingolipids1

Cholestane steroids $ Stigmastane steroids1

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	NPASS
(-)-Isocomene	present	NPASS
(-)-Modhephene	present	NPASS
(1S,2S,5R,8R)-2,5,8-trimethyl-6-methylidenetricyclo[6.3.0.01,5]undecane	present	NPASS
(2R,4S,5R,6R)-2-[[(2R,3S,4S,5R,6R)-6-[(2S,3S,4R)-3,4-dihydroxy-15-methyl-2-(octadecanoylamino)hexadecoxy]-3,4,5-trihydroxyoxan-2-yl]methoxy]-4-hydroxy-5-[(2-hydroxyacetyl)amino]-6-[(1R,2R)-1,2,3-trihydroxypropyl]oxane-2-carboxylic acid	present	LOTUS
16-[3-[4-[3,5-Dihydroxy-6-(hydroxymethyl)-4-methoxyoxan-2-yl]oxy-3,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5-[3,4-dihydroxy-6-methyl-5-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4-hydroxyoxan-2-yl]oxy-6-(4-hydroxy-4-methylpentyl)-2,6,13,17,17-pentamethyl-7-oxapentacyclo[10.8.0.02,9.05,9.013,18]icos-11-ene-4,8-dione	present	LOTUS
2,2':5',2''-Terthiophene	present	NPASS
24-Ethyl-5-alpha-cholest-22-en-3-beta-ol	present	LOTUS
24-Methyl-5-alpha-cholest-22-en-3-beta-ol	present	LOTUS
5-(3-Buten-1-ynyl)-2,2'-bithienyl	present	NPASS

05DNA & barcoding142 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apostichopus japonicus has left across the world's sequence archives.

At a glance

DNA specimens142

BINs1

Marker genes11

eDNA detections141

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P463 bp consensus122 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

9Tmostly conserved

12Cmostly conserved

45Gmostly conserved

60Tmostly conserved

126Gmostly conserved

129Tmostly conserved

147Amostly conserved

186Gmostly conserved

192Gmostly conserved

217Tmostly conserved

285Cvariable

345Amostly conserved

423Tmostly conserved

CTTCTTCTTGCCTCTGCAGGAGTTGAAAGAGGGGCCGGAACAGGGTGAACAATTTACCCTCCACTCTCAAGCAATATTGCCCACGCAGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 94 variants.

Diversity (π)1.0%

Haplotypes94

BIN1

Most divergent pair3.0%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apostichopus leukothelesame genus10.4%Apostichopus californicussame genus10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_012616 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1ND4LCOX2ATP8ATP6COX3ND3ND4ND5ND6CYTBND1ND2s-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apostichopus japonicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈703 154 174 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apostichopus japonicus0.70 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness91.1% BUSCO

08Occurrence & distribution

Record type896 records

Wild obs. + sensor270

Museum / vouchered626

Range

Area of Occupancy AOO808 km²

Depth

0–200 m sunlit0

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 809.5 m · max 816.3 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 4≤1 km 2≤10 km 5>10 km 47

58 georeferenced · 212 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 624 without coordinates

Open the institutions mapphysical evidence626

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	278
National Institute of Biological Resourceslocation not on record	28
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Cambridge, US	2

4 institutions · 311 of 626 vouchered records shown · 24 without an institution code

09Environmental DNA141 detections

Where the DNA of Apostichopus japonicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found141

Studies independent surveys3

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 141 detections have coordinates

Open the map5 countries0

Atlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.4 °C 15.9–19.8

pH8.01 7.89–8.18

Conductivity40,000 µS/cm 36,000–53,000

Salinity25.9 PSU 22.7–35.0

Dissolved oxygen7.98 mg/L 6.49–8.79

Turbidity0.485 NTU 0.31–0.7

Depth0.5 m 0.5–16.0

Coastal water

6 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-4.90 °C -4.90–19.4

Seasonal swing summer↔winter25.4 °C

Max temp (day)-3.80 °C -3.80–22.4

Min temp (night)-9.20 °C -9.20–16.6

Precipitation456 mm/mo 122–456

Air humidity70.5 % 58.5–70.5

Moisture balance417 mm/mo 17.5–417

Vapour deficit126 Pa 126–696

Wind speed3.40 m/s 1.70–3.40

Cloud cover59.8 % 42.4–59.8

CHELSA 1981–2010, ~9 km grid, at location & month of 113 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)