Aporophyla nigra

Haworth, 1809 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Aporophyla

At a glance

Occurrence records100 528

Data sources9

Biological traits2

DNA specimens36

eDNA detections34

Sources9 archives

Databases and archives Aporophyla nigra's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility100 528 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF100 528 records

Environmental DNA1 datasets · 8 countries34 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT · NCBI≈737 Mbp

01Narrative

Aporophyla nigra, the black rustic, is a moth of the family Noctuidae. The species was first described by Adrian Hardy Haworth in 1809. It is found from North Africa, through southern and central Europe to Anatolia, in the north it is found up to Scotland and southern Norway. It is also found in the Caucasus, Israel and Lebanon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporophyla nigra has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections34

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

139Amostly conserved

181Gmostly conserved

217Avariable

220Cvariable

328Gmostly conserved

364Avariable

478Tmostly conserved

496Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTGGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGGAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes13

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aporophyla australissame genus4.0%Aporophyla lutulentasame genus5.6%Eremohadena halimisame family5.6%Eremohadena marianasame family5.6%Aporophyla lueneburgensissame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aporophyla nigra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈736 874 160 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aporophyla nigra0.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.1% BUSCO

08Occurrence & distribution

Record type100 528 records

Wild obs. + sensor99 054

Museum / vouchered604

Other870

Origin

Native81

Range

Area of Occupancy AOO36 152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 6 942≤1 km 1 414≤10 km 88 306>10 km 138

96 800 georeferenced · 2 254 without coordinates

Open the mapobservation + sensor99 054

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 90≤1 km 88≤10 km 115>10 km 7

300 georeferenced · 304 without coordinates

Open the institutions mapphysical evidence604

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	212
NHMOlocation not on record	43
DABUHlocation not on record	36
CBDClocation not on record	31
NTNU-VMlocation not on record	26
DanishLepidopterologicalSocietylocation not on record	23
Podgorica, ME	22
Provincia di Livornolocation not on record	21
Nijmegen, NL	17
Durban Natural Science Museumlocation not on record	16
Tartu, EE	13
NCMGlocation not on record	13
Natural History Museum Rotterdamlocation not on record	10
Helsinki, FI	9
Zürich, CH	7
Muzeum Górnośląskie w Bytomiulocation not on record	7
Radicondoli, IT	5
South Kensington, GB	5
Bern, CH	4
Sion, CH	4
Natural History Museum, Londonlocation not on record	3
Banyoles, ES	2
National Institute of Biological Resourceslocation not on record	2
ZSMlocation not on record	2
Naturmuseum St. Gallenlocation not on record	2
Philadelphia, US	2
Frauenfeld, CH	2
UGRlocation not on record	1
Archäologie und Museum Baselland - Museum.BLlocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

30 institutions · 542 of 604 vouchered records shown · 62 without an institution code

09Environmental DNA34 detections

Where the DNA of Aporophyla nigra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map8 countries0

Chenaies a Chene vert des collines corses (G…mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 9.60–16.7

Seasonal swing summer↔winter15.4 °C

Max temp (day)16.9 °C 12.4–20.5

Min temp (night)9.60 °C 6.30–12.7

Precipitation74.3 mm/mo 49.7–205

Air humidity63.5 % 58.3–65.3

Moisture balance23.0 mm/mo -33.9–138

Vapour deficit539 Pa 428–744

Wind speed3.80 m/s 2.30–6.20

Cloud cover44.0 % 39.3–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aporophyla nigra

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type100 528 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type100 528 records