Aporophyla australis

Boisduval, 1829 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Aporophyla

At a glance

Occurrence records5 519

Data sources8

Biological traits2

DNA specimens21

eDNA detections22

Sources8 archives

Databases and archives Aporophyla australis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 519 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 519 records

Environmental DNA1 datasets · 4 countries22 detections

DNA & barcodingBOLD21 specimens

Genome at a glanceNCBI≈790 Mbp

01Narrative

Aporophyla australis, the feathered brindle, is a moth in the family Noctuidae. The species was first described by Jean Baptiste Boisduval in 1829. It is found in western and southern Europe, North Africa and the Middle East.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporophyla australis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections22

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

4Amostly conserved

100Tmostly conserved

160Avariable

202Gvariable

328Amostly conserved

364Avariable

370Avariable

400Amostly conserved

529Avariable

625Gmostly conserved

637Avariable

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes7

BIN1

Most divergent pair1.5%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aporophyla nigrasame genus4.0%Aporophyla lutulentasame genus4.9%Aporophyla chioleucasame genus5.1%Aporophyla lueneburgensissame genus5.3%Eremohadena halimisame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Aporophyla australis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈789 985 784 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aporophyla australis0.79 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type5 519 records

Wild obs. + sensor5 397

Museum / vouchered75

Other47

Origin

Native7

Range

Area of Occupancy AOO2 952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 281≤1 km 135≤10 km 4 730>10 km 11

5 157 georeferenced · 240 without coordinates

Open the mapobservation + sensor5 397

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 17≤10 km 3

24 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nijmegen, NL	15
Durban Natural Science Museumlocation not on record	14
Tartu, EE	9
Helsinki, FI	5
NCMGlocation not on record	5
Provincia di Livornolocation not on record	4
Zürich, CH	3
DanishLepidopterologicalSocietylocation not on record	2
Radicondoli, IT	2
South Kensington, GB	2
ZSMlocation not on record	1
UMUlocation not on record	1
ZMAAlocation not on record	1
Natural History Museum, Londonlocation not on record	1

14 institutions · 65 of 75 vouchered records shown · 10 without an institution code

09Environmental DNA22 detections

Where the DNA of Aporophyla australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map4 countries0

Pinedes corses a Pinus laricio (G3.54)Chenaies a Chene vert des collines corses (G…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 11.6–18.7

Seasonal swing summer↔winter15.7 °C

Max temp (day)19.0 °C 14.5–22.2

Min temp (night)11.5 °C 8.10–15.8

Precipitation102 mm/mo 58.3–143

Air humidity61.3 % 56.8–62.8

Moisture balance61.8 mm/mo

Vapour deficit709 Pa 531–883

Wind speed4.30 m/s

Cloud cover44.8 % 37.0–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aporophyla australis

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 519 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 519 records