Aporophyla canescens

Duponchel, 1826 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Aporophyla

At a glance

Occurrence records827

Data sources6

Biological traits0

DNA specimens19

eDNA detections0

Sources6 archives

Databases and archives Aporophyla canescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility827 records↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF827 records

DNA & barcodingBOLD19 specimens

01Narrative

Aporophyla canescens is a moth of the family Noctuidae. It was described by Philogène Auguste Joseph Duponchel in 1826. It is found in Italy, Switzerland, Slovenia, Croatia, Albania, Bosnia and Herzegovina, Serbia, North Macedonia, Greece, Turkey, Israel, Portugal, Russia, as well as on Sardinia, Corsica, Sicily, Malta and Crete. The wingspan is 40–45 mm.Papillons de la Vienne Adults have been recorded on wing from August to November. The larvae feed on Asphodelus and Narcissus species.Moths and Butterflies of Europe and North Africa

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporophyla canescens has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

181Amostly conserved

205Avariable

238Tvariable

370Amostly conserved

542Cmostly conserved

622Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGACTATTAATTCGTGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes6

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aporophyla chioleucasame genus5.8%Aporophyla australissame genus5.9%Aporophyla lutulentasame genus6.1%Polymixis flavicinctasame family6.1%Polymixis collutasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type827 records

Wild obs. + sensor552

Museum / vouchered179

Other96

Origin

Native13

Range

Area of Occupancy AOO1 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 199≤1 km 70≤10 km 36>10 km 37

342 georeferenced · 210 without coordinates

Open the mapobservation + sensor552

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤1 km 8≤10 km 25

33 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	118
Sion, CH	12
Provincia di Livornolocation not on record	8
Zürich, CH	8
SFRAlocation not on record	1

5 institutions · 147 of 179 vouchered records shown · 32 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)