Aporinellus completus

Banks, 1917 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pompilidae/Aporinellus

At a glance

Occurrence records330

Data sources5

Biological traits0

DNA specimens48

eDNA detections51

Sources5 archives

Databases and archives Aporinellus completus's data was compiled from.

GBIFGlobal Biodiversity Information Facility330 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF330 records

Environmental DNA1 datasets · 2 countries51 detections

DNA & barcodingBOLD48 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporinellus completus has left across the world's sequence archives.

At a glance

DNA specimens48

BINs1

Marker genes1

eDNA detections51

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

7Cmostly conserved

26Gvariable

40Gmostly conserved

70Gvariable

145Gvariable

259Gmostly conserved

370Tmostly conserved

508Gmostly conserved

ATTATACTTTATTTTTGGTTTATGAGCAGGAACTATAGGGACTTCATTAAGAATATTAATTCGTATTGAGTTAGGGAGTCCTGGTCAAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes8

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aporinellus sexmaculatussame genus11.0%Aporinellus yucatanensissame genus13.9%Aporinellus rhodesianussame genus14.7%Amblyellus willowmorensissame family16.1%Agenioideus cinctellussame family17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type330 records

Wild obs. + sensor2

Museum / vouchered328

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤1 km 7≤10 km 11

18 georeferenced · 310 without coordinates

Open the institutions mapphysical evidence328

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	144
University of Guelphlocation not on record	95
WIlocation not on record	22
Cleveland Museum of Natural History, OH (CLEV)location not on record	16
OSUClocation not on record	15
University of Alabamalocation not on record	11
Santa Cruz, US	6
Cambridge, US	5
Royal British Columbia Museumlocation not on record	4
Universidad Católica de Manizaleslocation not on record	3
EL PASO, US	2
Colorado State Universitylocation not on record	2
Royal Saskatchewan Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
US	1

15 institutions · 328 of 328 vouchered records shown

09Environmental DNA51 detections

Where the DNA of Aporinellus completus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map2 countries0

4. Native Grassland4. Native Grassland | 4.4. Temperate Grassland3. Shrubland|3.4. Temperate Shrubland8. Desert | 8.1. Hot Desert1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 17.2–25.6

Seasonal swing summer↔winter23.4 °C

Max temp (day)28.1 °C 23.2–32.7

Min temp (night)13.2 °C 10.0–19.4

Precipitation23.3 mm/mo 4.20–39.3

Air humidity48.2 % 39.0–52.0

Moisture balance-142 mm/mo -177–-101

Vapour deficit1,295 Pa 916–1,813

Wind speed2.40 m/s 1.50–2.80

Cloud cover29.5 % 13.1–35.2

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)