Agenioideus cinctellus

(Spinola, 1808) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pompilidae/Agenioideus

At a glance

Occurrence records5 502

Data sources7

Biological traits2

DNA specimens98

eDNA detections245

Sources7 archives

Databases and archives Agenioideus cinctellus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 502 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI245 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics98 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 502 records

Environmental DNA3 datasets · 10 countries245 detections

DNA & barcodingBOLD98 specimens

01Narrative

Agenioideus cinctellus is a spider wasp of the subfamily Pompilinae with a Palearctic distribution.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding98 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agenioideus cinctellus has left across the world's sequence archives.

At a glance

DNA specimens98

BINs1

Marker genes1

eDNA detections245

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

22Cmostly conserved

34Amostly conserved

133Gmostly conserved

187Cmostly conserved

229Amostly conserved

298Amostly conserved

322Gmostly conserved

625Gmostly conserved

TTCATTATATTTTATTTTTGCCATGTGATCTGGAGCTTTAGGGACTTCTTTAAGAATATTAATTCGTATTGAATTAGGTAGACCGGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes5

BIN1

Most divergent pair1.5%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agenioideus nubeculasame genus13.4%Agenioideus gentilissame genus14.5%Agenioideus sericeussame genus14.8%Priocnemis nothasame family15.9%Telostegus excisussame family16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 502 records

Wild obs. + sensor3 439

Museum / vouchered2 063

Range

Area of Occupancy AOO8 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 2 161≤1 km 410≤10 km 607>10 km 8

3 186 georeferenced · 253 without coordinates

Open the mapobservation + sensor3 439

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 848≤1 km 521≤10 km 213

1 582 georeferenced · 481 without coordinates

Open the institutions mapphysical evidence2 063

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	491
NHMOlocation not on record	335
Stockholm, SE	254
Helsinki, FI	129
Philadelphia, US	107
Metsähallituslocation not on record	86
Zürich, CH	81
Provincia di Livornolocation not on record	68
Natural History Museum Rotterdamlocation not on record	62
NMOKlocation not on record	24
Trondheim, NO	24
ZSMlocation not on record	22
University of Guelph, Centre for Biodiversity Genomicslocation not on record	20
ZMAAlocation not on record	18
BioFokuslocation not on record	16
Tilburg, NL	13
Muzeum Górnośląskie w Bytomiulocation not on record	13
Tartu, EE	9
Bavarian State Collection of Zoologylocation not on record	8
Kawasaki Shi Tama Ku, JP	8
neflocation not on record	7
Paris, FR	6
Bonn, DE	6
MZLUlocation not on record	5
MNHWlocation not on record	4
CBDClocation not on record	3
Uniwersytet Łódzkilocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1
Natural History Museum, Londonlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Brussels, BE	1

31 institutions · 1 825 of 2 063 vouchered records shown · 238 without an institution code

09Environmental DNA245 detections

Where the DNA of Agenioideus cinctellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found245

Studies independent surveys3

Countries10

Verifiable raw sequence linked140

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 245 detections have coordinates

Open the map10 countries0

farmTemperate mixed forest1.1. Boreal Forest|1. Forest & Woodland4. Native Grassland | 4.4. Temperate Grassland3. Shrubland|3.4. Temperate ShrublandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 13.2–20.1

Seasonal swing summer↔winter19.6 °C

Max temp (day)19.9 °C 17.6–25.2

Min temp (night)12.9 °C 9.20–16.2

Precipitation77.0 mm/mo 55.2–103

Air humidity59.6 % 57.6–62.0

Moisture balance-42.7 mm/mo -86.1–0.8

Vapour deficit728 Pa 611–949

Wind speed3.00 m/s 2.20–4.00

Cloud cover42.6 % 38.0–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 243 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agenioideus cinctellus

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type5 502 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 502 records