Agenioideus nubecula

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pompilidae/Agenioideus

At a glance

Occurrence records218

Data sources6

Biological traits0

DNA specimens29

eDNA detections30

Sources6 archives

Databases and archives Agenioideus nubecula's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF218 records

Environmental DNA1 datasets · 10 countries30 detections

DNA & barcodingBOLD29 specimens

01Narrative

Agenioideus nubecula is een vliesvleugelig insect uit de familie van de spinnendoders (Pompilidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1874 door Costa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agenioideus nubecula has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections30

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 73 variable positions, in barcode order

24Gmostly conserved

30Amostly conserved

39Gmostly conserved

51Amostly conserved

69Gmostly conserved

72Gmostly conserved

81Tmostly conserved

84Cvariable

102Tmostly conserved

111Cmostly conserved

141Tmostly conserved

180Amostly conserved

186Amostly conserved

202Cmostly conserved

204Gmostly conserved

213Amostly conserved

219Cmostly conserved

237Gmostly conserved

240Gvariable

249Amostly conserved

262Cmostly conserved

267Amostly conserved

288Tmostly conserved

294Gmostly conserved

306Gmostly conserved

312Gmostly conserved

318Amostly conserved

324Amostly conserved

339Tmostly conserved

343Tmostly conserved

345Amostly conserved

355Cmostly conserved

369Amostly conserved

375Gmostly conserved

387Amostly conserved

414Amostly conserved

417Tmostly conserved

450Tmostly conserved

454Amostly conserved

458Amostly conserved

459Tmostly conserved

465Tmostly conserved

468Amostly conserved

496Tmostly conserved

516Tmostly conserved

522Tmostly conserved

531Gmostly conserved

564Gmostly conserved

567Gmostly conserved

591Amostly conserved

597Amostly conserved

609Cvariable

611Cmostly conserved

621Gmostly conserved

622Gmostly conserved

623Amostly conserved

624Tmostly conserved

625Cmostly conserved

626Cmostly conserved

627Tmostly conserved

629Tmostly conserved

632Tmostly conserved

634Tmostly conserved

635Amostly conserved

636Cmostly conserved

638Amostly conserved

639Amostly conserved

640Cmostly conserved

642Tmostly conserved

643Tmostly conserved

644Tmostly conserved

646Tmostly conserved

647Tmostly conserved

TTATATTTTATTTTTGCTATATGGGCTGGAACATTAGGGACATCTTTAAGAATATTAATTCGTATTGAGTTGGGATGTCCTGGCCAAGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.8%

Haplotypes3

BINs2

Most divergent pair0.46%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agenioideus gentilissame genus12.5%Agenioideus cinctellussame genus13.4%Agenioideus sericeussame genus14.7%Priocnemis germanasame family16.1%Telostegus excisussame family16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type218 records

Wild obs. + sensor142

Museum / vouchered76

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 37≤1 km 6≤10 km 51>10 km 9

103 georeferenced · 39 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 5≤1 km 5≤10 km 14

24 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cleveland Museum of Natural History, OH (CLEV)location not on record	30
Zürich, CH	20
ZSMlocation not on record	7
Bavarian State Collection of Zoologylocation not on record	5
European Distributed Institute of Taxonomy (EDIT)location not on record	4
Paris, FR	3
Provincia di Livornolocation not on record	2
IMEDEAlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

9 institutions · 73 of 76 vouchered records shown · 3 without an institution code

09Environmental DNA30 detections

Where the DNA of Agenioideus nubecula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map10 countries0

1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland|1.4. Temperate ForestMaquis

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 16.1–22.5

Seasonal swing summer↔winter17.2 °C

Max temp (day)23.2 °C 20.5–27.0

Min temp (night)13.5 °C 10.3–16.7

Precipitation26.1 mm/mo 6.30–78.5

Air humidity55.4 % 51.6–59.8

Moisture balance-124 mm/mo -159–-20.6

Vapour deficit933 Pa 782–1,277

Wind speed2.30 m/s 2.00–3.20

Cloud cover28.8 % 14.7–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)