Apogon unicolor

Steindachner & Döderlein, 1883 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Apogonidae/Apogon

At a glance

Occurrence records242

Data sources7

Biological traits6

DNA specimens34

eDNA detections34

Sources7 archives

Databases and archives Apogon unicolor's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility129 records↗

OBISOcean Biodiversity Information System113 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS242 records

Environmental DNA1 datasets · 1 countries34 detections

DNA & barcodingBOLD34 specimens

01Narrative

Apogon unicolor is een straalvinnige vissensoort uit de familie van kardinaalbaarzen (Apogonidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1883 door Steindachner & Döderlein.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length14 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max35 m

Depth min10 m

Vulnerability10

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apogon unicolor has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections34

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P641 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

315Avariable

486Amostly conserved

561Amostly conserved

TTTGGTGCTTGAGCCGGGATAGTCGGAACAGCTCTTAGCCTGCTCATTCGAGCTGAACTAAGTCAACCCGGGGCCCTTCTTGGCGACGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes9

BIN1

Most divergent pair0.47%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apogon talbotisame genus13.0%Apogon doryssasame genus15.0%Apogon crassicepssame genus15.0%Ostorhinchus novemfasciatussame family15.1%Apogon lativittatussame genus15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type242 records

Wild obs. + sensor13

Museum / vouchered224

Other5

Range

Area of Occupancy AOO436 km²

Depth

0–200 m sunlit77

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 16.5 m · max 46 m · 77 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3>10 km 1

4 georeferenced · 9 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 3≤1 km 1≤10 km 6>10 km 32

42 georeferenced · 182 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	43
Western Australian Museumlocation not on record	19
Kagoshima University Museumlocation not on record	11
Sydney, AU	5
Toronto, CA	2
Paris, FR	1
FishBaselocation not on record	1
Yokosuka City Museumlocation not on record	1
	1
Honolulu, US	1
National Marine Biodiversity Institute of Korealocation not on record	1

11 institutions · 86 of 224 vouchered records shown · 32 without an institution code

09Environmental DNA34 detections

Where the DNA of Apogon unicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.8–25.8

Seasonal swing summer↔winter11.1 °C

Max temp (day)26.7 °C

Min temp (night)24.4 °C

Precipitation164 mm/mo

Air humidity61.8 %

Moisture balance-21.9 mm/mo

Vapour deficit1,260 Pa

Wind speed6.00 m/s

Cloud cover49.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)