Apogon talboti

Smith, 1961 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Apogonidae/Apogon

At a glance

Occurrence records241

Data sources8

Biological traits6

DNA specimens4

eDNA detections7

Sources8 archives

Databases and archives Apogon talboti's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility102 records↗

OBISOcean Biodiversity Information System139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS241 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD4 specimens

Genome at a glanceGoaT · NCBI≈881 Mbp

01Narrative

Ostorhinchus talboti is een straalvinnige vissensoort uit de familie van de kardinaalbaarzen (Apogonidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1961 door Smith.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length14 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max37 m

Depth min0 m

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apogon talboti has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 81 variable positions, in barcode order

31Gmostly conserved

40Gmostly conserved

43Amostly conserved

46Tmostly conserved

61Cmostly conserved

64Amostly conserved

67Cmostly conserved

88Cmostly conserved

91Tmostly conserved

94Tmostly conserved

100Cmostly conserved

106Gmostly conserved

112Tmostly conserved

118Amostly conserved

148Cmostly conserved

175Tmostly conserved

178Amostly conserved

184Cmostly conserved

196Gmostly conserved

197Gmostly conserved

211Tmostly conserved

220Tmostly conserved

235Cmostly conserved

244Cmostly conserved

250Amostly conserved

253Cmostly conserved

259Gmostly conserved

280Cmostly conserved

292Cmostly conserved

301Cmostly conserved

310Amostly conserved

313Gmostly conserved

322Cmostly conserved

331Amostly conserved

334Amostly conserved

346Tmostly conserved

364Tmostly conserved

373Cmostly conserved

385Cvariable

394Tmostly conserved

397Tmostly conserved

404Tmostly conserved

406Gmostly conserved

409Amostly conserved

412Tmostly conserved

415Tmostly conserved

433Cmostly conserved

436Tmostly conserved

448Tmostly conserved

466Gmostly conserved

469Tmostly conserved

484Gmostly conserved

490Avariable

493Cmostly conserved

497Tmostly conserved

508Amostly conserved

514Cmostly conserved

517Cmostly conserved

532Cmostly conserved

535Amostly conserved

536Tmostly conserved

538Gmostly conserved

553Cmostly conserved

556Gmostly conserved

562Cvariable

565Cmostly conserved

574Gmostly conserved

580Tmostly conserved

583Gmostly conserved

592Cmostly conserved

593Cmostly conserved

598Tmostly conserved

604Tmostly conserved

610Tmostly conserved

616Amostly conserved

622Amostly conserved

625Cmostly conserved

628Amostly conserved

640Tmostly conserved

649Cmostly conserved

650Cmostly conserved

CCTCTATCTAGTATTTGGTGCTTGAGCCGGGATAGTCGGGACAGCTCTTAGCCTGCTCATCCGAGCCGAGCTAAGTCAACCCGGGGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.3%

Haplotypes4

BINs2

Most divergent pair12.4%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apogon unicolorsame genus13.0%Nectamia viriasame family13.0%Ostorhinchus fasciatussame family13.4%Jaydia truncatasame family14.1%Ostorhinchus nigrocinctasame family14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apogon talboti carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈881 320 852 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apogon talboti0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type241 records

Wild obs. + sensor11

Museum / vouchered230

Range

Area of Occupancy AOO400 km²

Depth

0–200 m sunlit53

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 13.5 m · max 35 m · 53 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 2≤10 km 1>10 km 2

9 georeferenced · 2 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 13≤1 km 39≤10 km 7>10 km 25

84 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence230

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	22
Western Australian Museumlocation not on record	19
Sydney, AU	16
Natick, US	9
Museum and Art Gallery of the Northern Territorylocation not on record	7
Toronto, CA	4
Chicago, US	4
CASlocation not on record	3
Honolulu, US	3
South African Institute for Aquatic Biodiversitylocation not on record	3
Kagoshima University Museumlocation not on record	2
	1
Frankfurt am Main	1

13 institutions · 94 of 230 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Apogon talboti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 14.0–14.0

Seasonal swing summer↔winter20.7 °C

Max temp (day)19.1 °C

Min temp (night)6.90 °C

Precipitation17.3 mm/mo

Air humidity47.5 %

Moisture balance-91.3 mm/mo

Vapour deficit837 Pa

Wind speed5.00 m/s

Cloud cover21.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)