Apodrepanulatrix liberaria

Walker, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Apodrepanulatrix

At a glance

Occurrence records179

Data sources7

Biological traits0

DNA specimens15

eDNA detections13

Sources7 archives

Databases and archives Apodrepanulatrix liberaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility179 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF179 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD15 specimens

01Narrative

Apodrepanulatrix liberaria, the New Jersey tea inchworm, is a moth in the family Geometridae. It was described by Francis Walker in 1860. It is found from extreme southern Quebec and southern Ontario southward into northern Florida and Mississippi. It is listed as endangered by state authorities in the US state of Connecticut."Connecticut's Endangered, Threatened and Special Concern Species 2015". State of Connecticut Department of Energy and Environmental Protection Bureau of Natural Resources. Retrieved November 13, 2017. The wingspan is 25–35 mm. The larvae feed on Ceanothus americanus.BugGuide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apodrepanulatrix liberaria has left across the world's sequence archives.

At a glance

DNA specimens15

BINs3

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

46Cmostly conserved

106Cvariable

118Tmostly conserved

172Tmostly conserved

205Tmostly conserved

217Tmostly conserved

235Cmostly conserved

268Amostly conserved

352Tmostly conserved

364Cvariable

367Tmostly conserved

370Gvariable

397Tmostly conserved

421Tmostly conserved

508Tmostly conserved

532Cmostly conserved

547Amostly conserved

565Tmostly conserved

616Cmostly conserved

622Cmostly conserved

628Amostly conserved

634Tmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes4

BINs3

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apodrepanulatrix litariasame genus2.4%Cabera elatinasame family5.2%Astygisa morosasame family5.3%Pterospoda nigrescenssame family5.3%Astygisa circulariasame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type179 records

Wild obs. + sensor70

Museum / vouchered109

Range

Area of Occupancy AOO404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 8≤1 km 7≤10 km 11>10 km 43

69 georeferenced · 1 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤1 km 22≤10 km 55>10 km 8

85 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence109

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	34
Cambridge, US	21
East Lansing, US	21
Washington, US	16
St. Paul, US	6
Mississippi State, US	3
King Saud Universitylocation not on record	2
Georgia Museum of Natural Historylocation not on record	2
UNHClocation not on record	2
Colorado State Universitylocation not on record	1
Cornell University Insect Collectionlocation not on record	1

11 institutions · 109 of 109 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Apodrepanulatrix liberaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 16.5–16.5

Seasonal swing summer↔winter25.7 °C

Max temp (day)21.2 °C

Min temp (night)13.0 °C

Precipitation87.4 mm/mo

Air humidity60.5 %

Moisture balance-13.2 mm/mo

Vapour deficit740 Pa

Wind speed3.70 m/s

Cloud cover49.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)