Apocellus sphaericollis

(Say, 1831) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Apocellus

At a glance

Occurrence records46

Data sources5

Biological traits0

DNA specimens9

eDNA detections4

Sources5 archives

Databases and archives Apocellus sphaericollis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility46 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF46 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD9 specimens

01Narrative

Apocellus sphaericollis is a species of spiny-legged rove beetle in the family Staphylinidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apocellus sphaericollis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes2

BIN1

Most divergent pair1.8%

Where individuals differ — all 12 variable positions, in barcode order

23Avariable

130Cvariable

181Tvariable

328Gvariable

397Cvariable

463Tvariable

466Gvariable

539Tvariable

565Gvariable

574Gvariable

628Avariable

634Cvariable

AACTCTATACTTTATTTTTGGAACTTGAGCAGGTATAGTAGGTACATCTTTAAGTATATTAATTCGAGCAGAATTGGGAGCCCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Haploglossa marginalissame family16.0%Dexiogyia corticinasame family16.0%Acrotona parvulasame family16.3%Aleochara bimaculatasame family16.4%Quedius scintillanssame family17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type46 records

Wild obs. + sensor10

Museum / vouchered36

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 6≤1 km 2≤10 km 1

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 4

5 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	23
University of Guelphlocation not on record	4
Universidad Católica de Manizaleslocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Espace pour la vielocation not on record	1
Lubbock, US	1
Lake Placid, US	1
Lexington, US	1
North Carolina State University Insect Museumlocation not on record	1

9 institutions · 35 of 36 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Apocellus sphaericollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

farmBlack Spruce Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 14.6–18.0

Seasonal swing summer↔winter28.1 °C

Max temp (day)23.2 °C 19.5–23.2

Min temp (night)13.7 °C 10.9–13.7

Precipitation90.2 mm/mo 90.2–114

Air humidity57.9 % 57.9–59.6

Moisture balance-52.6 mm/mo -52.6–25.6

Vapour deficit866 Pa 677–866

Wind speed3.20 m/s 3.00–3.20

Cloud cover42.1 % 42.1–55.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)