Aplomya theclarum

(Scudder, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Aplomya

At a glance

Occurrence records57

Data sources6

Biological traits0

DNA specimens97

eDNA detections110

Sources6 archives

Databases and archives Aplomya theclarum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI110 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics97 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 2 countries110 detections

DNA & barcodingBOLD97 specimens

01Narrative

Aplomya theclarum is een vliegensoort uit de familie van de sluipvliegen (Tachinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1887 door Scudder.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding97 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplomya theclarum has left across the world's sequence archives.

At a glance

DNA specimens97

BINs2

Marker genes1

eDNA detections110

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus79 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

4Tmostly conserved

81Cmostly conserved

84Amostly conserved

108Gmostly conserved

141Tmostly conserved

156Cmostly conserved

204Cmostly conserved

231Tmostly conserved

255Cmostly conserved

283Cmostly conserved

339Cmostly conserved

345Amostly conserved

372Amostly conserved

444Cmostly conserved

492Tmostly conserved

507Tvariable

546Tmostly conserved

556Tmostly conserved

595Tmostly conserved

615Tmostly conserved

645Cmostly conserved

ACTTTATATTTTATTTTTGGAGCTTGATCAGGAATAATTGGAACTTCTTTAAGAATTTTAATTCGAGCAGAATTAGGTCACCCAGGTTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes13

BINs2

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplomya confinissame genus1.8%Lespesia schizuraesame family7.6%Medina collarissame family7.9%Lespesia aurulanssame family8.1%Lespesia datanarumsame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor1

Museum / vouchered56

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	23
University of Guelphlocation not on record	17
Essig Museum of Entomologylocation not on record	1

3 institutions · 41 of 56 vouchered records shown · 15 without an institution code

09Environmental DNA110 detections

Where the DNA of Aplomya theclarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found110

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 110 detections have coordinates

Open the map2 countries0

GrasslandMixed habitat4. Native Grassland3. Shrubland | 3.4. Temperate ShrublandMeadowsweet, Spiraea albaUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 13.6–23.7

Seasonal swing summer↔winter23.2 °C

Max temp (day)23.3 °C 19.0–29.8

Min temp (night)12.5 °C 7.80–18.2

Precipitation43.5 mm/mo 5.30–107

Air humidity52.6 % 41.6–60.0

Moisture balance-67.9 mm/mo -190–31.9

Vapour deficit1,007 Pa 676–1,534

Wind speed2.80 m/s 2.10–4.50

Cloud cover31.6 % 14.7–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 98 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)