Aplomya confinis

(Fallén, 1820) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Aplomya

At a glance

Occurrence records1 114

Data sources6

Biological traits2

DNA specimens23

eDNA detections132

Sources6 archives

Databases and archives Aplomya confinis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI132 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 114 records

Environmental DNA4 datasets · 8 countries132 detections

DNA & barcodingBOLD23 specimens

01Narrative

Aplomya confinis is een vliegensoort uit de familie van de sluipvliegen (Tachinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1820 door Fallen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplomya confinis has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes2

eDNA detections132

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

49Tmostly conserved

343Cmostly conserved

472Cmostly conserved

490Cmostly conserved

634Tmostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGAGCTTGATCAGGAATAATTGGAACTTCTTTAAGAATTTTAATTCGAGCAGAATTAGGTCATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes7

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplomya theclarumsame genus1.8%Aplomya metallicasame genus5.8%Meigenia submissasame family8.1%Meigenia dorsalissame family8.1%Medina collarissame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 114 records

Wild obs. + sensor790

Museum / vouchered323

Cultivated / captive1

Range

Area of Occupancy AOO2 296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 490≤1 km 175≤10 km 82>10 km 8

755 georeferenced · 35 without coordinates

Open the mapobservation + sensor790

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 161≤1 km 107≤10 km 24>10 km 4

296 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence323

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	165
Helsinki, FI	34
University of Tokyo, Department of Zoologylocation not on record	13
NHMOlocation not on record	9
Metsähallituslocation not on record	7
South Kensington, GB	5
Iwate Prefectural Museumlocation not on record	2
IMEDEAlocation not on record	1
CBDClocation not on record	1
Finnish Museum of Natural History, Zoological Museumlocation not on record	1

10 institutions · 238 of 323 vouchered records shown · 85 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA132 detections

Where the DNA of Aplomya confinis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found132

Studies independent surveys4

Countries8

Verifiable raw sequence linked99

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 132 detections have coordinates

Open the map8 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…Hay meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 9.10–16.8

Seasonal swing summer↔winter21.6 °C

Max temp (day)17.7 °C 13.3–20.5

Min temp (night)10.5 °C 5.50–12.9

Precipitation85.0 mm/mo 54.9–101

Air humidity59.0 % 56.7–62.5

Moisture balance-17.0 mm/mo -56.4–27.9

Vapour deficit660 Pa 478–776

Wind speed2.70 m/s 1.80–4.50

Cloud cover50.9 % 39.1–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 130 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplomya confinis

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 114 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions2 of 10 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 114 records