Aplidium stellatum

(Verrill, 1871) · species

image placeholder — illustration coming later

Animalia/Chordata/Ascidiacea/Aplousobranchia/Polyclinidae/Aplidium

At a glance

Occurrence records965

Data sources7

Biological traits4

DNA specimens9

eDNA detections8

Sources7 archives

Databases and archives Aplidium stellatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility734 records↗

OBISOcean Biodiversity Information System231 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS965 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Aplidium stellatum is een zakpijpensoort uit de familie van de Polyclinidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1871 door Verrill.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length20 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits1

Depth min2 m

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplidium stellatum has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P606 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.89%

Haplotypes2

BIN1

Most divergent pair0.83%

Where individuals differ — all 13 variable positions, in barcode order

20Gmostly conserved

82Tmostly conserved

169Gmostly conserved

193Tmostly conserved

295Amostly conserved

322Tvariable

325Tvariable

331Amostly conserved

364Tmostly conserved

439Avariable

512Tvariable

532Tvariable

553Cvariable

AATTTGATCAGCTTTTTTTGGAACTGCTTTGAGTTTATTAGTTCGGTTGGAGCTTTCTCAAACTGGTCAAATTATTGGTAATAGGCAAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplidium conicumsame genus15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type965 records

Wild obs. + sensor785

Museum / vouchered178

Other2

Range

Area of Occupancy AOO1 448 km²

Depth

0–200 m sunlit127

200–1000 m twilight0

1–4 km midnight1

>4 km abyssal0

median 18 m · max 3 400 m · 128 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 392≤1 km 87≤10 km 48>10 km 19

546 georeferenced · 239 without coordinates

Open the mapobservation + sensor785

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 10>10 km 3

13 georeferenced · 165 without coordinates

Open the institutions mapphysical evidence178

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	23
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
New Haven, US	7
Cambridge, US	4
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	1
CASlocation not on record	1

6 institutions · 47 of 178 vouchered records shown · 52 without an institution code

09Environmental DNA8 detections

Where the DNA of Aplidium stellatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–18.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C 18.4–20.5

Min temp (night)8.20 °C 8.20–16.8

Precipitation79.6 mm/mo 49.4–79.6

Air humidity57.3 % 57.3–61.9

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa 733–834

Wind speed5.80 m/s

Cloud cover36.7 % 36.7–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)