Aplidium conicum

(Olivi, 1792) · species

image placeholder — illustration coming later

Animalia/Chordata/Ascidiacea/Aplousobranchia/Polyclinidae/Aplidium

At a glance

Occurrence records958

Data sources9

Biological traits2

DNA specimens16

eDNA detections5

Sources9 archives

Databases and archives Aplidium conicum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility729 records↗

OBISOcean Biodiversity Information System229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS39 compounds

Occurrence & distributionGBIF · OBIS958 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD16 specimens

01Narrative

Aplidium conicum is een zakpijpensoort uit de familie van de Polyclinidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1792 door Olivi.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition39 compounds

Compounds documented for Aplidium conicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cholestane steroids4

Agarofuran sesquiterpenoids3

Cannabinoids3

Merosesquiterpenoids2

Flavanones2

Documented compounds39 total

Tissue Source Quantified only

Compound	Amount	Source
(1aS,4aS,7S,8aR)-7-hydroxy-3-[(1R,2R,3R)-2-(2-hydroxyethyl)-2-methyl-3-[(2R)-6-methylheptan-2-yl]cyclopentyl]-4a-methyl-5,6,7,8-tetrahydro-1aH-naphtho[4,4a-b]oxiren-4-one	present	LOTUS
(1R,3aS,7aS)-3,3,6-trimethylspiro[3a,4,5,7a-tetrahydro-2-benzofuran-1,5'-cyclohex-2-ene]-1',4'-dione	present	LOTUS
(2R)-2-(2-phenylethyl)-2,3-dihydrochromen-4-one	present	NPASS
(2S)-2-methyl-2-(4-methylpent-3-enyl)chromen-6-ol	present	LOTUS
(4S,4aR,6S,8aS)-4,6-dihydroxy-2-[(1R,2R,3R)-2-(2-hydroxyethyl)-2-methyl-3-[(2R)-6-methylheptan-2-yl]cyclopentyl]-8a-methyl-4,4a,5,6,7,8-hexahydronaphthalen-1-one	present	LOTUS
(6aS,10aR)-6,6,9-trimethyl-6a,7,8,10a-tetrahydrobenzo[c]chromen-2-ol	present	LOTUS
(6R)-6-[(1E)-2,6-dimethylhepta-1,5-dienyl]-3-[(2E)-3,7-dimethylocta-2,6-dienyl]-2-hydroxy-8,8-dioxo-6,9,10,11-tetrahydrochromeno[4,3-g][1,4]benzothiazine-7,12-dione	present	LOTUS
(6S)-6-[(1E)-2,6-dimethylhepta-1,5-dienyl]-4-[(2E)-3,7-dimethylocta-2,6-dienyl]-2-hydroxy-8,8-dioxo-6,9,10,11-tetrahydrochromeno[4,3-g][1,4]benzothiazine-7,12-dione	present	LOTUS
1,5-Diphenylpentan-3-ol	present	NPASS
2-((2E)-3,7-Dimethyl-2,6-octadien-1-yl)-1,4-benzenediol	present	LOTUS

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplidium conicum has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes12

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P600 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Diversity (π)6.4%

Haplotypes2

BINs2

Most divergent pair2.5%

Where individuals differ — all 75 variable positions, in barcode order

1Tmostly conserved

4Amostly conserved

7Tmostly conserved

8Tmostly conserved

9Tmostly conserved

11Gmostly conserved

12Amostly conserved

13Amostly conserved

14Tmostly conserved

15Tmostly conserved

17Gmostly conserved

18Amostly conserved

19Tmostly conserved

22Gmostly conserved

23Cmostly conserved

28Tmostly conserved

29Tmostly conserved

30Tmostly conserved

32Gmostly conserved

33Amostly conserved

34Amostly conserved

37Gmostly conserved

38Cmostly conserved

39Tmostly conserved

40Tmostly conserved

41Tmostly conserved

42Amostly conserved

43Amostly conserved

44Gmostly conserved

45Tmostly conserved

49Tmostly conserved

52Gmostly conserved

53Tmostly conserved

56Gmostly conserved

57Amostly conserved

58Cmostly conserved

59Tmostly conserved

60Tmostly conserved

61Gmostly conserved

62Amostly conserved

63Amostly conserved

65Tmostly conserved

66Gmostly conserved

67Tmostly conserved

68Cmostly conserved

69Tvariable

70Cmostly conserved

71Amostly conserved

72Amostly conserved

74Cmostly conserved

75Tvariable

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Cmostly conserved

80Amostly conserved

81Amostly conserved

82Gmostly conserved

86Tmostly conserved

87Tmostly conserved

89Gmostly conserved

90Amostly conserved

120Amostly conserved

123Tmostly conserved

129Tmostly conserved

171Avariable

315Tmostly conserved

324Tmostly conserved

330Tmostly conserved

333Tmostly conserved

336Tmostly conserved

360Cvariable

543Amostly conserved

552Tmostly conserved

555Amostly conserved

TTTATTTTTAGAATTTGATCTGCTTTTTTTAGAACTGCTTTAAGTTTATTAGTACGACTTGAATTGTCTCAAACTAGGCAAGTTATTAGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplidium stellatumsame genus15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_013584 ↗ · 13 protein · 24 tRNA · 2 rRNA

COX2ND5ND6ND4LCOX3ND1CYTBND3COX1ND2ATP8ATP6ND4rrnSrrnL

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type958 records

Wild obs. + sensor736

Museum / vouchered2

Other220

Origin

Native567

Range

Area of Occupancy AOO1 208 km²

Depth

0–200 m sunlit228

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 47.2 m · max 95.4 m · 228 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 13≤1 km 683≤10 km 8

704 georeferenced · 32 without coordinates

Open the mapobservation + sensor736

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
IEO-COMA-CSIClocation not on record	1

1 institutions · 1 of 2 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Aplidium conicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C

Min temp (night)9.30 °C

Precipitation72.2 mm/mo

Air humidity58.3 %

Moisture balance-20.6 mm/mo

Vapour deficit782 Pa

Wind speed2.60 m/s

Cloud cover40.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)