Apistogramma steindachneri

(Regan, 1908) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Apistogramma

At a glance

Occurrence records269

Data sources7

Biological traits5

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Apistogramma steindachneri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility269 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF269 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Steindachners Zwergbuntbarsch (Apistogramma steindachneri) ist eine kleine Fischart aus der Familie der Buntbarsche (Cichlidae), die im nordöstlichen Südamerika im östlichen Venezuela, in Guyana und Suriname in den Stromgebieten von Cuyuní, Venamo, Essequibo, Demerara, Mahaica, Marowijne und Corantijn vorkommt. Steindachners Zwergbuntbarsch wurde zu Ehren des österreichischen Zoologen Franz Steindachner benannt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6.53 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apistogramma steindachneri has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGCAGGTACCGCATTAAGCGTACTAATTCGAGCAGAACTTACTCAACCCGGCTCCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apistogramma barlowisame genus11.6%Apistogramma agassiziisame genus14.3%Apistogramma atahualpasame genus14.7%Apistogramma rositaesame genus14.9%Apistogramma gephyrasame genus15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type269 records

Wild obs. + sensor9

Museum / vouchered260

Range

Area of Occupancy AOO748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 8 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 16≤1 km 11≤10 km 5>10 km 5

37 georeferenced · 223 without coordinates

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	50
Washington, US	49
Toronto, CA	48
Geneva, CH	22
Montgomery, US	21
Museu de Zoologia da Universidade de Sao Paulolocation not on record	15
Chicago, US	14
Ann Arbor, US	10
CASlocation not on record	8
Champaign, US	8
Stockholm, SE	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Cambridge, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
	1
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	1

17 institutions · 260 of 260 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Apistogramma steindachneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)