Apistogramma rositae

Römer, Römer & Hahn, 2006 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Apistogramma

At a glance

Occurrence records4

Data sources7

Biological traits4

DNA specimens9

eDNA detections9

Sources7 archives

Databases and archives Apistogramma rositae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Apistogramma rositae is een straalvinnige vissensoort uit de familie van de cichliden (Cichlidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 2006 door Römer, Römer & Hahn.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length4.04 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apistogramma rositae has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P579 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

42Amostly conserved

138Tvariable

TTTGGAGCCTGAGCTGGGATAGCAGGCACCGCATTAAGCATACTAATTCGAGCAGAACTTACTCAACCCGGCTCCTTTTTCGGAGACGAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apistogramma wollisame genus6.6%Apistogramma baenschisame genus9.3%Apistogramma barlowisame genus11.2%Apistogramma atahualpasame genus11.4%Apistogramma pantalonesame genus12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

10Collections & institutions

Institution	Specimens
CASlocation not on record	2

1 institutions · 2 of 4 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Apistogramma rositae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.6–25.7

Seasonal swing summer↔winter1.30 °C

Max temp (day)29.1 °C 29.1–29.7

Min temp (night)22.4 °C 22.4–22.8

Precipitation144 mm/mo 144–296

Air humidity68.5 % 68.5–71.5

Moisture balance17.9 mm/mo 17.9–163

Vapour deficit1,043 Pa 929–1,043

Wind speed0.8 m/s 0.7–0.8

Cloud cover57.9 % 57.0–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)