Apistogramma baenschi

Römer, Hahn, Römer, Soares & Wöhler, 2004 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Apistogramma

At a glance

Occurrence records32

Data sources8

Biological traits4

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Apistogramma baenschi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF32 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Der Inka-Zwergbuntbarsch (Apistogramma baenschi) ist eine kleine Buntbarschart aus dem nordwestlichen Peru. Das Verbreitungsgebiet liegt in der Region San Martín im unteren Einzugsbereich des Río Huallaga. Ihren wissenschaftlichen Artnamen trägt der Fisch zu Ehren von Hans A. Baensch, der einen Buchverlag für Aquaristiksachbücher gegründet hat und selber Autor entsprechender Bücher war.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length5.27 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apistogramma baenschi has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P579 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

12Amostly conserved

154Gmostly conserved

168Cmostly conserved

306Amostly conserved

315Gmostly conserved

366Avariable

405Cmostly conserved

423Cmostly conserved

474Cmostly conserved

480Amostly conserved

501Cvariable

513Gmostly conserved

552Cmostly conserved

TTTGGTGCCTGAGCTGGAATAGCAGGCACCGCACTAAGCATGCTTATTCGAGCAGAACTTACTCAACCCGGCTCCTTTTTCGGAGACGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.85%

Haplotypes3

BIN1

Most divergent pair1.0%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apistogramma wollisame genus8.4%Apistogramma rositaesame genus9.3%Apistogramma barlowisame genus12.6%Apistogramma atahualpasame genus13.5%Apistogramma pantalonesame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type32 records

Wild obs. + sensor2

Museum / vouchered30

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 30 records without

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SNSDlocation not on record	15
CASlocation not on record	12
Stockholm, SE	1
FishBaselocation not on record	1

4 institutions · 29 of 30 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Apistogramma baenschi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.6–25.7

Seasonal swing summer↔winter1.30 °C

Max temp (day)29.1 °C 29.1–29.7

Min temp (night)22.4 °C 22.4–22.8

Precipitation144 mm/mo 144–296

Air humidity68.5 % 68.5–71.5

Moisture balance17.9 mm/mo 17.9–163

Vapour deficit1,043 Pa 929–1,043

Wind speed0.8 m/s 0.7–0.8

Cloud cover57.9 % 57.0–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)