Apistogramma eunotus

Kullander, 1981 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Apistogramma

At a glance

Occurrence records141

Data sources6

Biological traits5

DNA specimens21

eDNA detections16

Sources6 archives

Databases and archives Apistogramma eunotus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF141 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD21 specimens

01Narrative

Apistogramma eunotus is een straalvinnige vissensoort uit de familie van de cichliden (Cichlidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1981 door Kullander.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length5.3 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability10

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apistogramma eunotus has left across the world's sequence archives.

At a glance

DNA specimens21

BINs5

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P579 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

105Avariable

147Gmostly conserved

150Gmostly conserved

162Tmostly conserved

198Cvariable

228Gmostly conserved

306Amostly conserved

321Gmostly conserved

348Tmostly conserved

414Avariable

417Avariable

520Tmostly conserved

522Amostly conserved

549Gvariable

558Tvariable

TTTGGTGCCTGAGCTGGTATAGCAGGAACCGCACTAAGCATGCTAATTCGAGCTGAACTAACTCAGCCCGGTTCCTTTTTTGGGGACGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes3

BINs5

Most divergent pair1.9%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apistogramma cinilabrasame genus2.9%Apistogramma moaesame genus7.1%Apistogramma paulmuellerisame genus8.3%Apistogramma barlowisame genus15.0%Apistogramma baenschisame genus15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type141 records

Museum / vouchered141

Range

Area of Occupancy AOO468 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 4

8 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence141

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	48
Stockholm, SE	15
Museu de Zoologia da Universidade de Sao Paulolocation not on record	13
Museu Paraense Emílio Goeldilocation not on record	12
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	10
CASlocation not on record	7
Pontificia Universidad Javeriana (PUJ)location not on record	5
UEMlocation not on record	4
Champaign, US	4
	3
Chicago, US	3
Montgomery, US	2
Londrina, BR	2
FishBaselocation not on record	2
SNSDlocation not on record	2
Toronto, CA	2
PUC-RSlocation not on record	2
Cambridge, US	1
Royal Museum for Central Africalocation not on record	1
Geneva, CH	1

20 institutions · 139 of 141 vouchered records shown · 2 without an institution code

09Environmental DNA16 detections

Where the DNA of Apistogramma eunotus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.6–25.7

Seasonal swing summer↔winter1.30 °C

Max temp (day)29.1 °C 29.1–29.6

Min temp (night)22.4 °C 22.4–22.7

Precipitation144 mm/mo 144–281

Air humidity68.5 % 68.5–71.2

Moisture balance17.9 mm/mo 17.9–149

Vapour deficit1,043 Pa 941–1,043

Wind speed0.8 m/s 0.7–0.8

Cloud cover57.9 % 57.1–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)