Aphthona nigriscutis

Foudras, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Aphthona

At a glance

Occurrence records89

Data sources7

Biological traits0

DNA specimens36

eDNA detections26

Sources7 archives

Databases and archives Aphthona nigriscutis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF89 records

Environmental DNA1 datasets · 3 countries26 detections

DNA & barcodingBOLD36 specimens

01Narrative

Aphthona nigriscutis is a root-feeding flea beetle of the genus Aphthona. It is one of five Aphthona spp. that has been used in Alberta, Canada to control leafy spurge, an invasive plant that reduces pasture quality and degrades natural habitats.Bourchier, R., Erb, S., McClay, A, and Gassman, A. 2001. Euphorbia esula (L.) (Leafy spurge) and Euphorbia cyparissias (L.) (Cypress Spurge) (Ephorbiaceae). In Mason, P. and Huber, S. (Eds). Biological control programmes against insects and weeds in Canada 1981-2000. CABI Publishing, Wallingford, UK. It, along with A. lacertosa, is one of only two biocontrol agents thought to be effective against leafy spurge. Larvae cause the most damage to the plant by feeding on the roots.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphthona nigriscutis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes2

eDNA detections26

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

4Amostly conserved

232Cmostly conserved

283Tmostly conserved

334Cmostly conserved

463Avariable

562Gmostly conserved

580Avariable

624Gmostly conserved

625Avariable

TTTATATTTCATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATACTAATTCGAACAGAATTAGGTAGACCAGGATCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes4

BIN1

Most divergent pair0.77%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphthona cyparissiaesame genus9.3%Aphthona flavasame genus11.2%Cregya oculatasame order14.1%Cordyligaster septentrionalissame order15.3%Cordyligaster capelliisame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type89 records

Wild obs. + sensor37

Museum / vouchered44

Other8

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 33 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 11>10 km 1

12 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Saskatchewan Museumlocation not on record	9
US	7
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
St. Paul, US	1

7 institutions · 23 of 44 vouchered records shown · 4 without an institution code

09Environmental DNA26 detections

Where the DNA of Aphthona nigriscutis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 15.4–25.0

Seasonal swing summer↔winter27.0 °C

Max temp (day)28.2 °C 18.9–30.8

Min temp (night)18.2 °C 12.1–20.7

Precipitation122 mm/mo 115–146

Air humidity57.4 % 56.8–58.3

Moisture balance-49.4 mm/mo -80.0–-24.8

Vapour deficit1,168 Pa 748–1,381

Wind speed5.50 m/s 4.90–5.50

Cloud cover33.8 % 25.5–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)