Aphthona flava

Guillebeau, 1894 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Aphthona

At a glance

Occurrence records67

Data sources7

Biological traits0

DNA specimens18

eDNA detections18

Sources7 archives

Databases and archives Aphthona flava's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility67 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF67 records

Environmental DNA1 datasets · 3 countries18 detections

DNA & barcodingBOLD18 specimens

01Narrative

Aphthona flava is a beetle of the genus Aphthona. It is native to Eurasia, and has been introduced into North America as a biocontrol agent for leafy spurge. Adults are brown and difficult to distinguish in the field from A. cyparissiae and A. nigriscutis. A. flava is still the dominant beetle at some Manitoba release sites, but it is relatively scarce in North Dakota and Minnesota. Besides Manitoba, it is widespread in Hungary and Italy.International distribution and ecology

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphthona flava has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes2

eDNA detections18

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

73Gmostly conserved

83Cvariable

190Amostly conserved

319Tmostly conserved

331Amostly conserved

484Tmostly conserved

502Cvariable

556Tvariable

562Tmostly conserved

AACTTTATACTTTATTTTTGGTATTTGATCAGGAATAATTGGAACTTCTTTAAGTATACTAATTCGAACAGAGTTAGGAAGACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes7

BIN1

Most divergent pair0.76%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphthona cyparissiaesame genus8.8%Aphthona nigriscutissame genus11.2%Systena hudsoniassame family12.8%Glyptina atriventrissame family12.9%Platynus cincticollissame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor48

Museum / vouchered15

Other4

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 5

6 georeferenced · 42 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 3

5 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	2
MZLUlocation not on record	2

2 institutions · 4 of 15 vouchered records shown · 2 without an institution code

09Environmental DNA18 detections

Where the DNA of Aphthona flava was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 16.5–23.0

Seasonal swing summer↔winter25.6 °C

Max temp (day)26.6 °C 20.0–28.2

Min temp (night)16.2 °C 12.3–18.2

Precipitation72.4 mm/mo 24.3–146

Air humidity57.1 % 51.3–58.3

Moisture balance-54.4 mm/mo -123–-42.4

Vapour deficit1,168 Pa 811–1,200

Wind speed4.80 m/s 2.00–5.50

Cloud cover34.1 % 33.8–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)