Aphrophora salicina

(Goeze, 1778) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphrophoridae/Aphrophora

At a glance

Occurrence records3 294

Data sources6

Biological traits2

DNA specimens148

eDNA detections195

Sources6 archives

Databases and archives Aphrophora salicina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 294 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI195 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics148 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 294 records

Environmental DNA2 datasets · 11 countries195 detections

DNA & barcodingBOLD148 specimens

01Narrative

Aphrophora salicina is een halfvleugelig insect uit de familie Aphrophoridae. De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd in 1778 door Goeze.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding148 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrophora salicina has left across the world's sequence archives.

At a glance

DNA specimens148

BINs3

Marker genes1

eDNA detections195

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P417 bp consensus144 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

1Avariable

28Tvariable

85Gvariable

103Cvariable

148Avariable

157Tvariable

167Tvariable

184Avariable

250Cmostly conserved

295Amostly conserved

304Avariable

307Avariable

338Cvariable

382Cvariable

388Avariable

409Amostly conserved

AATAAATAATATAAGATTTTGAATACTTCCACCATCATTAACATTATTATTATCAAGAAGTTTAGTAGATAATGGTGTAGGAACGGGTTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes13

BINs3

Most divergent pair6.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrophora alnisame genus6.0%Aphrophora similissame genus7.7%Aphrophora majorsame genus7.7%Aphrophora canadensissame genus10.1%Aphrophora princepssame genus10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 294 records

Wild obs. + sensor3 028

Museum / vouchered266

Range

Area of Occupancy AOO6 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 536≤1 km 284≤10 km 1 827>10 km 19

2 666 georeferenced · 362 without coordinates

Open the mapobservation + sensor3 028

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 52≤1 km 60≤10 km 5

117 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence266

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	21
Philadelphia, US	7
Tilburg, NL	4
Champaign, US	4
NCMGlocation not on record	4
SLU Artdatabankenlocation not on record	3
CBDClocation not on record	2
Jagiellonian University, Faculty of Biologylocation not on record	2
NHMOlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

10 institutions · 49 of 266 vouchered records shown · 217 without an institution code

09Environmental DNA195 detections

Where the DNA of Aphrophora salicina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found195

Studies independent surveys2

Countries11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 195 detections have coordinates

Open the map11 countries0

Agri_NatVeg.Floodplain forestBroad-leaved_forest.MaquisComplex_cultivation_patterns.Marais

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 14.0–23.4

Seasonal swing summer↔winter17.1 °C

Max temp (day)18.9 °C 18.1–27.9

Min temp (night)15.6 °C 8.60–16.7

Precipitation56.5 mm/mo 40.6–75.0

Air humidity61.7 % 52.0–63.3

Moisture balance-46.7 mm/mo -106–-4.30

Vapour deficit743 Pa 645–1,384

Wind speed2.90 m/s 1.90–4.50

Cloud cover42.4 % 28.0–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 184 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphrophora salicina

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type3 294 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 294 records