Aphrophora quadrinotata

Say, 1830 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphrophoridae/Aphrophora

At a glance

Occurrence records497

Data sources7

Biological traits0

DNA specimens14

eDNA detections12

Sources7 archives

Databases and archives Aphrophora quadrinotata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility497 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF497 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD14 specimens

01Narrative

Aphrophora quadrinotata, the four-spotted spittlebug, is a species of spittlebug in the family Aphrophoridae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrophora quadrinotata has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes3

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

3Cmostly conserved

10Cvariable

190Tvariable

271Avariable

TACTTTATACTTTATATTTGGAATTTGATCAGGAATAATTGGGACAACTCTAAGATTAATGATTCGAATTGAATTGGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes6

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrophora laeviorsame genus11.2%Xenaphrophora montanasame family13.4%Aphrophora canadensissame genus13.5%Aphrophora princepssame genus13.5%Aphrophora permutatasame genus13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type497 records

Wild obs. + sensor223

Museum / vouchered274

Range

Area of Occupancy AOO968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 109≤1 km 45≤10 km 10>10 km 25

189 georeferenced · 34 without coordinates

Open the mapobservation + sensor223

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 3≤1 km 34≤10 km 77

114 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence274

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	114
Wuzhou, CN	28
University Park, US	25
OSUClocation not on record	23
North Carolina State University Insect Museumlocation not on record	21
Mississippi State, US	19
Cambridge, US	12
University of Guelphlocation not on record	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
CUlocation not on record	1
Montgomery, US	1
WIlocation not on record	1
Washington, US	1
Cornell University Insect Collectionlocation not on record	1

14 institutions · 265 of 274 vouchered records shown · 9 without an institution code

09Environmental DNA12 detections

Where the DNA of Aphrophora quadrinotata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 15.6–21.7

Seasonal swing summer↔winter31.4 °C

Max temp (day)21.6 °C 21.6–24.2

Min temp (night)11.9 °C 11.9–19.9

Precipitation74.3 mm/mo 74.3–94.8

Air humidity59.1 % 58.0–59.1

Moisture balance-41.7 mm/mo -97.2–-35.5

Vapour deficit728 Pa 728–1,086

Wind speed3.10 m/s 2.90–6.10

Cloud cover40.2 % 39.2–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)