Aphrodita hastata

Moore, 1905 · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Phyllodocida/Aphroditidae/Aphrodita

At a glance

Occurrence records1 795

Data sources7

Biological traits2

DNA specimens6

eDNA detections304

Sources7 archives

Databases and archives Aphrodita hastata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility820 records↗

OBISOcean Biodiversity Information System975 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI304 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 795 records

Environmental DNA1 datasets · 1 countries304 detections

DNA & barcodingBOLD6 specimens

01Narrative

Aphroditella hastata is een borstelworm uit de familie Aphroditidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Aphroditella hastata werd in 1905 voor het eerst wetenschappelijk beschreven door Moore.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrodita hastata has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

eDNA detections304

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

10Amostly conserved

11Cmostly conserved

13Tmostly conserved

14Gmostly conserved

15Amostly conserved

16Tmostly conserved

17Cmostly conserved

18Amostly conserved

20Gmostly conserved

22Cmostly conserved

23Tmostly conserved

25Cmostly conserved

27Tmostly conserved

29Gmostly conserved

30Tmostly conserved

31Amostly conserved

32Cmostly conserved

168Tmostly conserved

271Cmostly conserved

363Cmostly conserved

612Gmostly conserved

ATTTTTGGTACTTGATCAGGCCTCCTTGGTACATCAATAAGTCTACTAATTCGTGCTGAATTAGGCCAACCCGGAGCCTTACTAGGAAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes3

BIN1

Most divergent pair0.32%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrodita aculeatasame genus7.2%Aphrodita longipalpasame genus9.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S-D9-D10

animal barcodemarker

08Occurrence & distribution

Record type1 795 records

Wild obs. + sensor1 107

Museum / vouchered686

Other2

Range

Area of Occupancy AOO3 400 km²

Depth

0–200 m sunlit518

200–1000 m twilight211

1–4 km midnight2

>4 km abyssal0

median 76.3 m · max 2 434.5 m · 731 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 420≤1 km 2

422 georeferenced · 685 without coordinates

Open the mapobservation + sensor1 107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 8≤10 km 22>10 km 11

41 georeferenced · 645 without coordinates

Open the institutions mapphysical evidence686

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	287
Cambridge, US	29
The Atlantic reference Centrelocation not on record	23
New Haven, US	18
Maurice Lamontagne Institutelocation not on record	18
Toronto, CA	15
Saint John, CA	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
WoRMS Editorial Boardlocation not on record	1
The Atlantic Reference Centre (ARC)location not on record	1

10 institutions · 397 of 686 vouchered records shown · 20 without an institution code

09Environmental DNA304 detections

Where the DNA of Aphrodita hastata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found304

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 304 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 17.4–17.6

Seasonal swing summer↔winter20.8 °C

Max temp (day)18.2 °C 18.1–18.4

Min temp (night)16.8 °C 16.7–16.9

Precipitation98.2 mm/mo 96.3–101

Air humidity68.1 % 67.7–68.7

Vapour deficit632 Pa 618–640

Cloud cover48.7 % 46.1–49.7

CHELSA 1981–2010, ~9 km grid, at location & month of 304 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphrodita hastata

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type1 795 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 795 records