Aphrodita aculeata

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Phyllodocida/Aphroditidae/Aphrodita

At a glance

Occurrence records23 450

Data sources10

Biological traits6

DNA specimens30

eDNA detections30

Sources10 archives

Databases and archives Aphrodita aculeata's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 845 records↗

OBISOcean Biodiversity Information System12 605 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.61 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS23 450 records

Environmental DNA2 datasets · 4 countries30 detections

DNA & barcodingBOLD30 specimens

Genome at a glanceGoaT606 Mbp

01Narrative

Dorsal view, removed from water Aphrodita aculeata, the sea mouse, is a marine polychaete worm found in the North Atlantic, the North Sea, the Baltic Sea and the Mediterranean. The sea mouse normally lies buried head-first in the sand. It has been found at depths of over 3000 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length20 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importanceof no interest\

Other traits2

Depth max49 m

Depth min37 m

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrodita aculeata has left across the world's sequence archives.

At a glance

DNA specimens30

BINs2

Marker genes2

eDNA detections30

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 128 variable positions, in barcode order

1Tmostly conserved

4Cmostly conserved

34Amostly conserved

37Cmostly conserved

43Tmostly conserved

46Amostly conserved

55Gmostly conserved

58Amostly conserved

61Gmostly conserved

64Tmostly conserved

67Cmostly conserved

74Tmostly conserved

76Amostly conserved

79Tmostly conserved

85Cmostly conserved

91Tmostly conserved

95Cmostly conserved

100Tmostly conserved

103Tmostly conserved

106Tmostly conserved

109Amostly conserved

115Cmostly conserved

118Cmostly conserved

124Cmostly conserved

130Cmostly conserved

133Tmostly conserved

136Tmostly conserved

142Tmostly conserved

151Tmostly conserved

154Cmostly conserved

163Gmostly conserved

169Amostly conserved

172Cmostly conserved

181Gmostly conserved

184Amostly conserved

190Cvariable

205Amostly conserved

208Tmostly conserved

214Amostly conserved

217Amostly conserved

218Gmostly conserved

238Tmostly conserved

241Tmostly conserved

250Cmostly conserved

259Cmostly conserved

262Amostly conserved

265Tmostly conserved

266Tmostly conserved

268Amostly conserved

271Cmostly conserved

274Amostly conserved

277Cmostly conserved

283Tmostly conserved

286Tmostly conserved

298Amostly conserved

304Amostly conserved

325Tmostly conserved

337Amostly conserved

340Cmostly conserved

346Tmostly conserved

352Gmostly conserved

355Tmostly conserved

364Amostly conserved

367Tmostly conserved

373Gmostly conserved

376Amostly conserved

382Amostly conserved

385Tmostly conserved

386Tmostly conserved

394Tmostly conserved

400Cmostly conserved

403Gmostly conserved

412Amostly conserved

415Gmostly conserved

421Tmostly conserved

427Cmostly conserved

428Cmostly conserved

430Tmostly conserved

442Tmostly conserved

451Cmostly conserved

454Cmostly conserved

457Gmostly conserved

460Cmostly conserved

469Amostly conserved

479Tmostly conserved

484Tmostly conserved

487Amostly conserved

493Tmostly conserved

496Cmostly conserved

499Cmostly conserved

500Cmostly conserved

502Avariable

508Amostly conserved

514Tmostly conserved

535Gmostly conserved

538Gmostly conserved

539Cmostly conserved

541Tmostly conserved

544Tmostly conserved

548Tmostly conserved

550Amostly conserved

556Cmostly conserved

559Tmostly conserved

562Tmostly conserved

565Amostly conserved

568Amostly conserved

571Cmostly conserved

577Amostly conserved

578Tmostly conserved

581Tmostly conserved

589Cmostly conserved

595Tmostly conserved

604Tmostly conserved

605Gmostly conserved

607Tmostly conserved

619Tmostly conserved

623Gmostly conserved

624Gmostly conserved

625Amostly conserved

628Amostly conserved

+8 more variable positions not shown

TACCCTATATTTTATTTTTGGCACTTGATCAGGACTCCTTGGTACATCAATAAGGCTACTGATTCGCGCCGAATTAGGTCAACCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.7%

Haplotypes11

BINs2

Most divergent pair18.8%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrodita hastatasame genus7.2%Aphrodita longipalpasame genus12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Aphrodita aculeata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size606 360 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphrodita aculeata0.61 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type23 450 records

Wild obs. + sensor5 783

Museum / vouchered9 506

Other8 161

Origin

Native204

Range

Area of Occupancy AOO32 396 km²

Depth

0–200 m sunlit8 926

200–1000 m twilight396

1–4 km midnight5

>4 km abyssal0

median 32.7 m · max 2 320 m · 9 327 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 4 158≤1 km 559≤10 km 237>10 km 201

5 155 georeferenced · 628 without coordinates

Open the mapobservation + sensor5 783

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 312≤1 km 495≤10 km 30>10 km 9

846 georeferenced · 8 660 without coordinates

Open the institutions mapphysical evidence9 506

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	429
RWSlocation not on record	316
SLU Artdatabankenlocation not on record	243
Gothenburg, SE	232
730location not on record	175
Bergen, NO	171
ICESlocation not on record	129
Stockholm, SE	105
DASSHlocation not on record	87
Institut Francais pour l'Etude de la Merlocation not on record	74
Frankfurt am Main	71
NHMOlocation not on record	57
ICATMARlocation not on record	53
National Marine Biodiversity Institute of Korealocation not on record	51
Station Biologique de Roscoff (EDMO:521)location not on record	46
Bergen, NO	42
NTNU-VMlocation not on record	40
486location not on record	36
MZLUlocation not on record	35
Norwegian Institute of Marine Researchlocation not on record	33
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	29
WMR_IMARESlocation not on record	15
Biomorlocation not on record	15
Natural History Museum Rotterdamlocation not on record	11
South Kensington, GB	10
Cambridge, US	6
Washington, US	5
PNHSlocation not on record	4
Helsinki, FI	3
UMAGlocation not on record	3
IEO-COMA-CSIClocation not on record	2
Natural History Museum, Londonlocation not on record	2
Istituto di Scienze Marine di Venezialocation not on record	2
ZSROlocation not on record	2
Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record	1
Plymouth Marine Laboratorylocation not on record	1
Buenos Aires, AR	1
UGentlocation not on record	1
Montgomery, US	1
Texas Cooperative Wildlife Collectionlocation not on record	1
Barcelona, ES	1
Laboratoire d'Océanographie Biologique, Universite de Bordeaxlocation not on record	1
BioFokuslocation not on record	1

43 institutions · 2 543 of 9 506 vouchered records shown · 2 100 without an institution code

09Environmental DNA30 detections

Where the DNA of Aphrodita aculeata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys2

Countries4

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map4 countries0

MUDSome soft mud in the netSandy mudSoft mud, some mud in the net

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 9.00–16.8

Seasonal swing summer↔winter13.4 °C

Max temp (day)13.7 °C 9.60–18.3

Min temp (night)10.2 °C 7.30–15.6

Precipitation67.6 mm/mo 54.3–123

Air humidity63.5 % 57.3–64.9

Vapour deficit553 Pa 410–704

Cloud cover48.0 % 40.4–59.1

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphrodita aculeata

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Record type23 450 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type23 450 records