Aphria ocypterata

Townsend, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Aphria

At a glance

Occurrence records95

Data sources7

Biological traits0

DNA specimens56

eDNA detections70

Sources7 archives

Databases and archives Aphria ocypterata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility95 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF95 records

Environmental DNA1 datasets · 3 countries70 detections

DNA & barcodingBOLD56 specimens

01Narrative

Aphria ocypterata is a species of bristle fly in the family Tachinidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphria ocypterata has left across the world's sequence archives.

At a glance

DNA specimens56

BINs1

Marker genes1

eDNA detections70

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P644 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

3Amostly conserved

4Cmostly conserved

6Amostly conserved

8Amostly conserved

622Gmostly conserved

633Tmostly conserved

ACACTATATTTTATTTTTGGTGCTTGATCAGGAATAGTAGGAACATCATTAAGAATTTTAGTACGAGCAGAATTAGGACATCCAGGAGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes5

BIN1

Most divergent pair0.31%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphria longirostrissame genus3.3%Coenosia atrasame order8.2%Fannia lepidasame order8.7%Tachina nitidasame family9.3%Peleteria aeneasame family9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type95 records

Wild obs. + sensor3

Museum / vouchered92

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2>10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	35
University of Guelphlocation not on record	17
Natural History Museum of Utahlocation not on record	1
Santa Cruz, US	1

4 institutions · 54 of 92 vouchered records shown · 38 without an institution code

09Environmental DNA70 detections

Where the DNA of Aphria ocypterata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map3 countries0

4. Native Grassland | 4.4. Temperate Grassland1. Forest | 1.4. Forest - Temperate1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland|1.4. Temperate Forest5. Wetlands (inland)4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 12.5–20.4

Seasonal swing summer↔winter30.4 °C

Max temp (day)25.7 °C 19.6–27.6

Min temp (night)11.1 °C 6.70–14.1

Precipitation50.8 mm/mo 28.7–70.2

Air humidity52.4 % 51.0–56.1

Moisture balance-108 mm/mo -119–-49.4

Vapour deficit1,064 Pa 639–1,173

Wind speed4.00 m/s 2.50–4.30

Cloud cover36.0 % 32.0–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 64 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)