Fannia lepida

(Wiedemann, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Fanniidae/Fannia

At a glance

Occurrence records604

Data sources7

Biological traits0

DNA specimens25

eDNA detections7

Sources7 archives

Databases and archives Fannia lepida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility604 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF604 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD25 specimens

01Narrative

Fannia lepida is a fly species in the Fanniidae family. This species is smaller and more slender than the house fly, Musca domestica, and is similar in appearance to the lesser house fly, Fannia canicularis. It is found in the Palearctic.Fauna Europaea For identification see Bei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi.Séguy, E. (1923) Diptères Anthomyides. Paris: Éditions Faune de France Faune n° 6 393 p., 813 fig.(FdeFr06)Dipt.Anthomyides.pdf Bibliotheque Virtuelle Numerique pdf

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fannia lepida has left across the world's sequence archives.

At a glance

DNA specimens25

BINs3

Marker genes1

eDNA detections7

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

1Amostly conserved

7Amostly conserved

49Amostly conserved

74Tmostly conserved

82Tmostly conserved

106Tvariable

118Tmostly conserved

121Tmostly conserved

133Cmostly conserved

157Tvariable

163Tmostly conserved

166Amostly conserved

202Tmostly conserved

212Tmostly conserved

301Tvariable

340Cmostly conserved

352Tvariable

400Amostly conserved

433Avariable

460Tmostly conserved

466Avariable

490Tmostly conserved

514Amostly conserved

596Cmostly conserved

619Cmostly conserved

631Tmostly conserved

646Cmostly conserved

AACCTTATATTTTATTTTTGGTGCTTGATCAGGAATAGTAGGAACTTCATTAAGTATTTTAATTCGAGCAGAATTAGGACATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes5

BINs3

Most divergent pair3.5%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stegosoma vinculatumsame order7.7%Pegomya winthemisame order7.8%Coenosia atrasame order7.9%Pegomya transgressasame order8.0%Sumpigaster fasciatasame order8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type604 records

Wild obs. + sensor221

Museum / vouchered381

Cultivated / captive2

Range

Area of Occupancy AOO1 292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 151≤1 km 43≤10 km 23

217 georeferenced · 4 without coordinates

Open the mapobservation + sensor221

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 312≤1 km 19≤10 km 45>10 km 1

377 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence381

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	26
NCMGlocation not on record	24
Tromsø, NO	9
SLU Artdatabankenlocation not on record	6
DFFW2018location not on record	5
CBDClocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
MZLUlocation not on record	2
DFFW2016location not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Copenhagen, DK	1

11 institutions · 79 of 381 vouchered records shown · 302 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Fannia lepida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Forest1. Forest & WoodlandForest at the edge of the field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 12.2–17.9

Seasonal swing summer↔winter25.2 °C

Max temp (day)19.0 °C 16.3–23.0

Min temp (night)10.2 °C 7.30–13.5

Precipitation128 mm/mo 83.5–151

Air humidity59.8 % 54.7–64.3

Moisture balance-3.80 mm/mo -42.4–36.9

Vapour deficit686 Pa 541–862

Wind speed3.10 m/s 2.30–3.10

Cloud cover49.8 % 40.2–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)